Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624423_at:

>probe:Drosophila_2:1624423_at:88:253; Interrogation_Position=349; Antisense; CAAGATTTATGGCTTCTCCTCCAAT
>probe:Drosophila_2:1624423_at:543:79; Interrogation_Position=384; Antisense; AGGTGTCCGTCAAACTCAATGGCGA
>probe:Drosophila_2:1624423_at:595:395; Interrogation_Position=407; Antisense; GACAAGGTGAAACTCCGTCTGGTCA
>probe:Drosophila_2:1624423_at:590:581; Interrogation_Position=426; Antisense; TGGTCACCCAAATGCCCAAGTTGAA
>probe:Drosophila_2:1624423_at:200:657; Interrogation_Position=466; Antisense; TAAGGCCGACATGCAGGTGAATCAG
>probe:Drosophila_2:1624423_at:468:711; Interrogation_Position=515; Antisense; TTCAACGTAACGCTCTTGGATGTGG
>probe:Drosophila_2:1624423_at:525:595; Interrogation_Position=535; Antisense; TGTGGAGGCCATAACGGTGACCGAT
>probe:Drosophila_2:1624423_at:690:537; Interrogation_Position=588; Antisense; GGTTTTTCCGCCTCAAGAATATCGA
>probe:Drosophila_2:1624423_at:128:185; Interrogation_Position=680; Antisense; AAAATCGCTCTGAATGTGGCTAATC
>probe:Drosophila_2:1624423_at:138:365; Interrogation_Position=726; Antisense; GAATAATGTTGCCTGAGACTCGACA
>probe:Drosophila_2:1624423_at:104:425; Interrogation_Position=740; Antisense; GAGACTCGACAGTTTTGGCAACCCC
>probe:Drosophila_2:1624423_at:503:201; Interrogation_Position=759; Antisense; AACCCCTTATGTTGCGAATGTTCAA
>probe:Drosophila_2:1624423_at:11:73; Interrogation_Position=786; Antisense; AGGCATTCGAACTAGTTCCCATCGA
>probe:Drosophila_2:1624423_at:323:307; Interrogation_Position=804; Antisense; CCATCGACCAGTTTCTCAAGGAGTA

Paste this into a BLAST search page for me
CAAGATTTATGGCTTCTCCTCCAATAGGTGTCCGTCAAACTCAATGGCGAGACAAGGTGAAACTCCGTCTGGTCATGGTCACCCAAATGCCCAAGTTGAATAAGGCCGACATGCAGGTGAATCAGTTCAACGTAACGCTCTTGGATGTGGTGTGGAGGCCATAACGGTGACCGATGGTTTTTCCGCCTCAAGAATATCGAAAAATCGCTCTGAATGTGGCTAATCGAATAATGTTGCCTGAGACTCGACAGAGACTCGACAGTTTTGGCAACCCCAACCCCTTATGTTGCGAATGTTCAAAGGCATTCGAACTAGTTCCCATCGACCATCGACCAGTTTCTCAAGGAGTA

Full Affymetrix probeset data:

Annotations for 1624423_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime