FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624424_at:

>probe:Drosophila_2:1624424_at:348:401; Interrogation_Position=409; Antisense; GACAGTCGCTTCGATTACTACAGCT
>probe:Drosophila_2:1624424_at:282:383; Interrogation_Position=459; Antisense; GAACTACAGCTGCATACCGGAGGTT
>probe:Drosophila_2:1624424_at:682:723; Interrogation_Position=482; Antisense; TTGGGCTGTTCGTGGTGTATACTCA
>probe:Drosophila_2:1624424_at:725:667; Interrogation_Position=501; Antisense; TACTCAGCCTAGTGCCTACTTGAAT
>probe:Drosophila_2:1624424_at:357:615; Interrogation_Position=521; Antisense; TGAATGCCTCACTGACCTGTTCAAA
>probe:Drosophila_2:1624424_at:247:549; Interrogation_Position=552; Antisense; GGAGTTCACTGGTAGTCTGGCCCAC
>probe:Drosophila_2:1624424_at:292:657; Interrogation_Position=657; Antisense; TAATGTCTATCTGGCCTATGTGGGT
>probe:Drosophila_2:1624424_at:141:519; Interrogation_Position=676; Antisense; GTGGGTTTGGCCTACAACAGCTCAA
>probe:Drosophila_2:1624424_at:540:5; Interrogation_Position=705; Antisense; ATTGAGCCCACTGGACTTCAGGAAC
>probe:Drosophila_2:1624424_at:422:423; Interrogation_Position=739; Antisense; GAGAGCTTGCAGTGCTTTCTTTACA
>probe:Drosophila_2:1624424_at:359:589; Interrogation_Position=777; Antisense; TGGTCATCCTCGAGTTGGTGGTGAT
>probe:Drosophila_2:1624424_at:561:553; Interrogation_Position=867; Antisense; GGAGCTGCCCTTTATCTGCGAAATC
>probe:Drosophila_2:1624424_at:697:647; Interrogation_Position=904; Antisense; TCAACTTTCGGCTGGGAGCAGTCCA
>probe:Drosophila_2:1624424_at:498:41; Interrogation_Position=943; Antisense; ATCGGCCCAAATGCAGTCTTCGAGT

Paste this into a BLAST search page for me
GACAGTCGCTTCGATTACTACAGCTGAACTACAGCTGCATACCGGAGGTTTTGGGCTGTTCGTGGTGTATACTCATACTCAGCCTAGTGCCTACTTGAATTGAATGCCTCACTGACCTGTTCAAAGGAGTTCACTGGTAGTCTGGCCCACTAATGTCTATCTGGCCTATGTGGGTGTGGGTTTGGCCTACAACAGCTCAAATTGAGCCCACTGGACTTCAGGAACGAGAGCTTGCAGTGCTTTCTTTACATGGTCATCCTCGAGTTGGTGGTGATGGAGCTGCCCTTTATCTGCGAAATCTCAACTTTCGGCTGGGAGCAGTCCAATCGGCCCAAATGCAGTCTTCGAGT

Full Affymetrix probeset data:

Annotations for 1624424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720