FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624425_at:

>probe:Drosophila_2:1624425_at:271:625; Interrogation_Position=1686; Antisense; TGCGCCATCTGGACGAATCAAACTA
>probe:Drosophila_2:1624425_at:470:131; Interrogation_Position=1737; Antisense; ACCGACATAGTTTCTCAATGCCACA
>probe:Drosophila_2:1624425_at:347:531; Interrogation_Position=1823; Antisense; GGGTTTAATCCACCAGCAGTAGAAC
>probe:Drosophila_2:1624425_at:450:659; Interrogation_Position=1869; Antisense; TAAGCAGACCATCGCAACGGAGCCA
>probe:Drosophila_2:1624425_at:306:295; Interrogation_Position=1941; Antisense; CGAGCATGCCATCGCAAGTGGGAAA
>probe:Drosophila_2:1624425_at:567:137; Interrogation_Position=1968; Antisense; ACGAGCCAGCTAGGGATGCGGCCAT
>probe:Drosophila_2:1624425_at:35:253; Interrogation_Position=1994; Antisense; CAAGTCGCGAGCTCCAAGAGATTTA
>probe:Drosophila_2:1624425_at:28:459; Interrogation_Position=2013; Antisense; GATTTACGGTAACACCAGCTCGAGT
>probe:Drosophila_2:1624425_at:397:493; Interrogation_Position=2060; Antisense; GTCAAGTCCATTTGGGTTTCCACTC
>probe:Drosophila_2:1624425_at:80:481; Interrogation_Position=2075; Antisense; GTTTCCACTCTCACAGATCTTTGTA
>probe:Drosophila_2:1624425_at:83:237; Interrogation_Position=2138; Antisense; AATTAGTTGTTATACTCCAGCAGGG
>probe:Drosophila_2:1624425_at:380:525; Interrogation_Position=2162; Antisense; GGGTATGTCCGTACAGAATCTGTGA
>probe:Drosophila_2:1624425_at:161:677; Interrogation_Position=2187; Antisense; TAGTGCTAACCTGCAATGGCGTCCA
>probe:Drosophila_2:1624425_at:244:329; Interrogation_Position=2205; Antisense; GCGTCCATAGCATAGTTAAGCGTAT

Paste this into a BLAST search page for me
TGCGCCATCTGGACGAATCAAACTAACCGACATAGTTTCTCAATGCCACAGGGTTTAATCCACCAGCAGTAGAACTAAGCAGACCATCGCAACGGAGCCACGAGCATGCCATCGCAAGTGGGAAAACGAGCCAGCTAGGGATGCGGCCATCAAGTCGCGAGCTCCAAGAGATTTAGATTTACGGTAACACCAGCTCGAGTGTCAAGTCCATTTGGGTTTCCACTCGTTTCCACTCTCACAGATCTTTGTAAATTAGTTGTTATACTCCAGCAGGGGGGTATGTCCGTACAGAATCTGTGATAGTGCTAACCTGCAATGGCGTCCAGCGTCCATAGCATAGTTAAGCGTAT

Full Affymetrix probeset data:

Annotations for 1624425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720