FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624427_at:

>probe:Drosophila_2:1624427_at:568:101; Interrogation_Position=1014; Antisense; AGACGCAGGTTCAGGCTGGACTAGA
>probe:Drosophila_2:1624427_at:11:433; Interrogation_Position=1040; Antisense; GAGTCCAACTTCAGTGGTGCCGATG
>probe:Drosophila_2:1624427_at:203:179; Interrogation_Position=1079; Antisense; AAACTCTTGCCAGATGGTCTGCTGC
>probe:Drosophila_2:1624427_at:690:617; Interrogation_Position=1101; Antisense; TGCAGACCTTCGATCAGCACGAGGA
>probe:Drosophila_2:1624427_at:116:449; Interrogation_Position=1157; Antisense; GATCCGTGGATCTTTGCTTCGCTCA
>probe:Drosophila_2:1624427_at:367:649; Interrogation_Position=1179; Antisense; TCAGCTACGATGGTCGCGTCATAAT
>probe:Drosophila_2:1624427_at:51:329; Interrogation_Position=1194; Antisense; GCGTCATAATCTCAAAGGTGCCCAA
>probe:Drosophila_2:1624427_at:550:175; Interrogation_Position=1294; Antisense; AAACGAATTGTGTCCTTGTATGTAG
>probe:Drosophila_2:1624427_at:681:85; Interrogation_Position=813; Antisense; AGTGCCATTTGGTCACCGGCGGTGA
>probe:Drosophila_2:1624427_at:728:149; Interrogation_Position=846; Antisense; ACTTGAGGATCTGGGACTGTCGCAT
>probe:Drosophila_2:1624427_at:465:293; Interrogation_Position=898; Antisense; CGATCATTCGCATTGGGTCTGGTGC
>probe:Drosophila_2:1624427_at:709:499; Interrogation_Position=914; Antisense; GTCTGGTGCGTTCGCTTCAACACAT
>probe:Drosophila_2:1624427_at:657:629; Interrogation_Position=965; Antisense; TCCAGTGACTGCAAGGTGCTGCTCA
>probe:Drosophila_2:1624427_at:560:649; Interrogation_Position=987; Antisense; TCACGTGTGCGGGATCGGTTAGTTC

Paste this into a BLAST search page for me
AGACGCAGGTTCAGGCTGGACTAGAGAGTCCAACTTCAGTGGTGCCGATGAAACTCTTGCCAGATGGTCTGCTGCTGCAGACCTTCGATCAGCACGAGGAGATCCGTGGATCTTTGCTTCGCTCATCAGCTACGATGGTCGCGTCATAATGCGTCATAATCTCAAAGGTGCCCAAAAACGAATTGTGTCCTTGTATGTAGAGTGCCATTTGGTCACCGGCGGTGAACTTGAGGATCTGGGACTGTCGCATCGATCATTCGCATTGGGTCTGGTGCGTCTGGTGCGTTCGCTTCAACACATTCCAGTGACTGCAAGGTGCTGCTCATCACGTGTGCGGGATCGGTTAGTTC

Full Affymetrix probeset data:

Annotations for 1624427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720