Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624428_at:

>probe:Drosophila_2:1624428_at:101:631; Interrogation_Position=110; Antisense; TCCCGAAGAAGCTAACAGGCGTCAT
>probe:Drosophila_2:1624428_at:456:185; Interrogation_Position=135; Antisense; AAAATCTGCATTCGCACCTACGATA
>probe:Drosophila_2:1624428_at:130:659; Interrogation_Position=215; Antisense; TAACGACTACTGTCGCCGTTCGGAT
>probe:Drosophila_2:1624428_at:493:301; Interrogation_Position=230; Antisense; CCGTTCGGATTCTGGATGGTCAGAT
>probe:Drosophila_2:1624428_at:102:165; Interrogation_Position=25; Antisense; AAAACTATTTCAAGCGTTACGCCAT
>probe:Drosophila_2:1624428_at:322:443; Interrogation_Position=252; Antisense; GATGTTAGCCGATGTGATCTTCTGC
>probe:Drosophila_2:1624428_at:487:453; Interrogation_Position=267; Antisense; GATCTTCTGCGAATAGCCTGTTTAT
>probe:Drosophila_2:1624428_at:446:125; Interrogation_Position=281; Antisense; AGCCTGTTTATCTACTGTGCGCGAT
>probe:Drosophila_2:1624428_at:232:625; Interrogation_Position=298; Antisense; TGCGCGATTGCGAAACACCGACTTG
>probe:Drosophila_2:1624428_at:39:713; Interrogation_Position=320; Antisense; TTGCAAGAATGTTGCCCACCGCATG
>probe:Drosophila_2:1624428_at:638:303; Interrogation_Position=338; Antisense; CCGCATGCGTCTTTGGTGAAAATTT
>probe:Drosophila_2:1624428_at:134:315; Interrogation_Position=45; Antisense; GCCATGTTAAAACTTTTGCTGCCAT
>probe:Drosophila_2:1624428_at:101:337; Interrogation_Position=62; Antisense; GCTGCCATTAGCTATTGTGTGCCTG
>probe:Drosophila_2:1624428_at:231:517; Interrogation_Position=78; Antisense; GTGTGCCTGTTTATGGCTCACATAC

Paste this into a BLAST search page for me
TCCCGAAGAAGCTAACAGGCGTCATAAAATCTGCATTCGCACCTACGATATAACGACTACTGTCGCCGTTCGGATCCGTTCGGATTCTGGATGGTCAGATAAAACTATTTCAAGCGTTACGCCATGATGTTAGCCGATGTGATCTTCTGCGATCTTCTGCGAATAGCCTGTTTATAGCCTGTTTATCTACTGTGCGCGATTGCGCGATTGCGAAACACCGACTTGTTGCAAGAATGTTGCCCACCGCATGCCGCATGCGTCTTTGGTGAAAATTTGCCATGTTAAAACTTTTGCTGCCATGCTGCCATTAGCTATTGTGTGCCTGGTGTGCCTGTTTATGGCTCACATAC

Full Affymetrix probeset data:

Annotations for 1624428_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime