FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624429_at:

>probe:Drosophila_2:1624429_at:547:169; Interrogation_Position=1416; Antisense; AAAGCCAGTCCACAAAAATTGCACA
>probe:Drosophila_2:1624429_at:164:181; Interrogation_Position=1429; Antisense; AAAAATTGCACACGGCTGCTTCACA
>probe:Drosophila_2:1624429_at:539:357; Interrogation_Position=1436; Antisense; GCACACGGCTGCTTCACATAAAAGA
>probe:Drosophila_2:1624429_at:306:1; Interrogation_Position=1505; Antisense; ATAACCATTGTACAAAGCTTTGATT
>probe:Drosophila_2:1624429_at:116:181; Interrogation_Position=1567; Antisense; AAACAACCGATGAATTTACTTAATG
>probe:Drosophila_2:1624429_at:440:109; Interrogation_Position=1605; Antisense; AGAAGAAGCTGCACTTGCCGCATGC
>probe:Drosophila_2:1624429_at:125:203; Interrogation_Position=1644; Antisense; AACCACCCACATTGCAACACAAGAA
>probe:Drosophila_2:1624429_at:577:163; Interrogation_Position=1677; Antisense; AAATATGAAGAGTATCAGCCCACTA
>probe:Drosophila_2:1624429_at:597:483; Interrogation_Position=1688; Antisense; GTATCAGCCCACTAAATCGGATCCG
>probe:Drosophila_2:1624429_at:292:41; Interrogation_Position=1703; Antisense; ATCGGATCCGTTACACAAGACACAC
>probe:Drosophila_2:1624429_at:155:397; Interrogation_Position=1721; Antisense; GACACACGAAAATACCTGACAAATT
>probe:Drosophila_2:1624429_at:258:17; Interrogation_Position=1778; Antisense; ATTTAACTACATACTTGTTGGTCGT
>probe:Drosophila_2:1624429_at:634:627; Interrogation_Position=1789; Antisense; TACTTGTTGGTCGTAACTTATTTCG
>probe:Drosophila_2:1624429_at:56:687; Interrogation_Position=1807; Antisense; TATTTCGTTTTTTCTCGAGCAATAA

Paste this into a BLAST search page for me
AAAGCCAGTCCACAAAAATTGCACAAAAAATTGCACACGGCTGCTTCACAGCACACGGCTGCTTCACATAAAAGAATAACCATTGTACAAAGCTTTGATTAAACAACCGATGAATTTACTTAATGAGAAGAAGCTGCACTTGCCGCATGCAACCACCCACATTGCAACACAAGAAAAATATGAAGAGTATCAGCCCACTAGTATCAGCCCACTAAATCGGATCCGATCGGATCCGTTACACAAGACACACGACACACGAAAATACCTGACAAATTATTTAACTACATACTTGTTGGTCGTTACTTGTTGGTCGTAACTTATTTCGTATTTCGTTTTTTCTCGAGCAATAA

Full Affymetrix probeset data:

Annotations for 1624429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720