FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624430_at:

>probe:Drosophila_2:1624430_at:179:147; Interrogation_Position=1062; Antisense; ACTCATTCTAATGGCACAGGCTCAA
>probe:Drosophila_2:1624430_at:463:153; Interrogation_Position=1077; Antisense; ACAGGCTCAACGACCTTTGGAGATT
>probe:Drosophila_2:1624430_at:700:89; Interrogation_Position=1113; Antisense; AGTAATTATCATATCCCTCGACACC
>probe:Drosophila_2:1624430_at:246:651; Interrogation_Position=1157; Antisense; TCACATACAGATTTTTCGCGGTTAT
>probe:Drosophila_2:1624430_at:319:547; Interrogation_Position=644; Antisense; GGATGATGTGCGTCTCAAGCCAAAT
>probe:Drosophila_2:1624430_at:615:53; Interrogation_Position=673; Antisense; ATGCACTTGGGCTATCTGGCCAATA
>probe:Drosophila_2:1624430_at:138:213; Interrogation_Position=737; Antisense; AAGACTGTGACTTCTTGGCCAGCAT
>probe:Drosophila_2:1624430_at:59:479; Interrogation_Position=811; Antisense; GTTTTTGGACTCTTATTGGCATCTA
>probe:Drosophila_2:1624430_at:702:569; Interrogation_Position=828; Antisense; GGCATCTAATCTGTTTACCACATCC
>probe:Drosophila_2:1624430_at:178:153; Interrogation_Position=847; Antisense; ACATCCTGTTTACTTTGCTGCATGG
>probe:Drosophila_2:1624430_at:720:67; Interrogation_Position=868; Antisense; ATGGCGTACTATACCGTCGTCGAAG
>probe:Drosophila_2:1624430_at:435:719; Interrogation_Position=912; Antisense; TTCCTATATGATGCTCTTTGCTAGT
>probe:Drosophila_2:1624430_at:586:721; Interrogation_Position=929; Antisense; TTGCTAGTGTAGCTGCCCAGTTCTA
>probe:Drosophila_2:1624430_at:347:93; Interrogation_Position=947; Antisense; AGTTCTACGTTGTCAGCTCACACGG

Paste this into a BLAST search page for me
ACTCATTCTAATGGCACAGGCTCAAACAGGCTCAACGACCTTTGGAGATTAGTAATTATCATATCCCTCGACACCTCACATACAGATTTTTCGCGGTTATGGATGATGTGCGTCTCAAGCCAAATATGCACTTGGGCTATCTGGCCAATAAAGACTGTGACTTCTTGGCCAGCATGTTTTTGGACTCTTATTGGCATCTAGGCATCTAATCTGTTTACCACATCCACATCCTGTTTACTTTGCTGCATGGATGGCGTACTATACCGTCGTCGAAGTTCCTATATGATGCTCTTTGCTAGTTTGCTAGTGTAGCTGCCCAGTTCTAAGTTCTACGTTGTCAGCTCACACGG

Full Affymetrix probeset data:

Annotations for 1624430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720