FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624431_at:

>probe:Drosophila_2:1624431_at:206:429; Interrogation_Position=112; Antisense; GAGTACGACGACTGCACGAGTTTTA
>probe:Drosophila_2:1624431_at:319:355; Interrogation_Position=125; Antisense; GCACGAGTTTTAAGGCGCGCTTCCA
>probe:Drosophila_2:1624431_at:110:299; Interrogation_Position=140; Antisense; CGCGCTTCCACCAGTACTTTATATT
>probe:Drosophila_2:1624431_at:265:399; Interrogation_Position=172; Antisense; GACACAGATTGCTCCCAATGGCTAA
>probe:Drosophila_2:1624431_at:298:67; Interrogation_Position=189; Antisense; ATGGCTAACTGATTACCGTAACTGC
>probe:Drosophila_2:1624431_at:169:381; Interrogation_Position=214; Antisense; GAACGATATCAGCAGTCCAACGGGA
>probe:Drosophila_2:1624431_at:297:583; Interrogation_Position=245; Antisense; TGGCTGCCGGCAAAGCGGTGATTAA
>probe:Drosophila_2:1624431_at:201:109; Interrogation_Position=338; Antisense; AGAAGCCACCGCTGGATTGGGCTGC
>probe:Drosophila_2:1624431_at:203:283; Interrogation_Position=362; Antisense; CTCCTCTGCCGGACTGGATGGAGAA
>probe:Drosophila_2:1624431_at:139:423; Interrogation_Position=394; Antisense; GAGAATACCTATCTTGAGCTTAAGC
>probe:Drosophila_2:1624431_at:335:171; Interrogation_Position=421; Antisense; AAAGAGCTCTCTGGACAGGCGGCGC
>probe:Drosophila_2:1624431_at:641:73; Interrogation_Position=455; Antisense; AGGAACGCTCGCTGTGCACGATCAT
>probe:Drosophila_2:1624431_at:547:677; Interrogation_Position=68; Antisense; TAGATGACGCATGGGCAATCCGACC
>probe:Drosophila_2:1624431_at:454:631; Interrogation_Position=86; Antisense; TCCGACCCTGTCATCTGTACAAGGA

Paste this into a BLAST search page for me
GAGTACGACGACTGCACGAGTTTTAGCACGAGTTTTAAGGCGCGCTTCCACGCGCTTCCACCAGTACTTTATATTGACACAGATTGCTCCCAATGGCTAAATGGCTAACTGATTACCGTAACTGCGAACGATATCAGCAGTCCAACGGGATGGCTGCCGGCAAAGCGGTGATTAAAGAAGCCACCGCTGGATTGGGCTGCCTCCTCTGCCGGACTGGATGGAGAAGAGAATACCTATCTTGAGCTTAAGCAAAGAGCTCTCTGGACAGGCGGCGCAGGAACGCTCGCTGTGCACGATCATTAGATGACGCATGGGCAATCCGACCTCCGACCCTGTCATCTGTACAAGGA

Full Affymetrix probeset data:

Annotations for 1624431_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720