Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624432_at:

>probe:Drosophila_2:1624432_at:311:395; Interrogation_Position=1995; Antisense; GAAATTGTCACACCGTACTGGGCAT
>probe:Drosophila_2:1624432_at:3:593; Interrogation_Position=2013; Antisense; TGGGCATCGAACTCCGCGGGTAAGA
>probe:Drosophila_2:1624432_at:90:165; Interrogation_Position=2051; Antisense; AAATACTCAGCATTTCGAGCAGGCG
>probe:Drosophila_2:1624432_at:473:295; Interrogation_Position=2066; Antisense; CGAGCAGGCGATTCACCAGGAGGTT
>probe:Drosophila_2:1624432_at:37:619; Interrogation_Position=2091; Antisense; TGCAGCAATACCCAAACTCCAAGAT
>probe:Drosophila_2:1624432_at:137:585; Interrogation_Position=2151; Antisense; TGGCATAGATTACTCGCCTACGATC
>probe:Drosophila_2:1624432_at:663:315; Interrogation_Position=2166; Antisense; GCCTACGATCCTGATAACGATTGCA
>probe:Drosophila_2:1624432_at:372:705; Interrogation_Position=2200; Antisense; TTATGGATTGGTTCCTGTTTCCTTC
>probe:Drosophila_2:1624432_at:63:307; Interrogation_Position=2220; Antisense; CCTTCGTGCTGTGTCTGTAGATGTA
>probe:Drosophila_2:1624432_at:94:237; Interrogation_Position=2244; Antisense; AATCCCTAGATTACCTGACTCTGAG
>probe:Drosophila_2:1624432_at:660:135; Interrogation_Position=2364; Antisense; ACGTAAGCCCTAATCGGTAGCTCTA
>probe:Drosophila_2:1624432_at:614:303; Interrogation_Position=2424; Antisense; CCGAGCCATATGTATATCTCCACTA
>probe:Drosophila_2:1624432_at:445:189; Interrogation_Position=2469; Antisense; AACATGCGATATTACTCAGCCTCCA
>probe:Drosophila_2:1624432_at:121:263; Interrogation_Position=2485; Antisense; CAGCCTCCATTTTTATTGTACGGTA

Paste this into a BLAST search page for me
GAAATTGTCACACCGTACTGGGCATTGGGCATCGAACTCCGCGGGTAAGAAAATACTCAGCATTTCGAGCAGGCGCGAGCAGGCGATTCACCAGGAGGTTTGCAGCAATACCCAAACTCCAAGATTGGCATAGATTACTCGCCTACGATCGCCTACGATCCTGATAACGATTGCATTATGGATTGGTTCCTGTTTCCTTCCCTTCGTGCTGTGTCTGTAGATGTAAATCCCTAGATTACCTGACTCTGAGACGTAAGCCCTAATCGGTAGCTCTACCGAGCCATATGTATATCTCCACTAAACATGCGATATTACTCAGCCTCCACAGCCTCCATTTTTATTGTACGGTA

Full Affymetrix probeset data:

Annotations for 1624432_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime