FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624433_at:

>probe:Drosophila_2:1624433_at:222:499; Interrogation_Position=1017; Antisense; GTCGGTCCTCAAACCATGGGACTAT
>probe:Drosophila_2:1624433_at:704:559; Interrogation_Position=1133; Antisense; GGAACCTACCCTAATGGTGCGAGTA
>probe:Drosophila_2:1624433_at:625:185; Interrogation_Position=1158; Antisense; AACAACCTTGATCTGAGTGTCCTCT
>probe:Drosophila_2:1624433_at:30:723; Interrogation_Position=1224; Antisense; TTGCCCGAAGCTAATGACGCCATCT
>probe:Drosophila_2:1624433_at:266:279; Interrogation_Position=1247; Antisense; CTATGGCGTTCGTAATTCCTGTATA
>probe:Drosophila_2:1624433_at:713:685; Interrogation_Position=1294; Antisense; TATAACTTACAGCTAGTCGCCATCC
>probe:Drosophila_2:1624433_at:562:365; Interrogation_Position=1343; Antisense; GAATACAACTCAAGGCTGTGTCCGT
>probe:Drosophila_2:1624433_at:193:287; Interrogation_Position=1358; Antisense; CTGTGTCCGTTAAGCCGCATATAAA
>probe:Drosophila_2:1624433_at:103:257; Interrogation_Position=1437; Antisense; CAAAGCCCAGAGTGCAGCTGCAGTT
>probe:Drosophila_2:1624433_at:463:177; Interrogation_Position=1473; Antisense; AAACGATCAGCCATATCCGGTAGCC
>probe:Drosophila_2:1624433_at:359:657; Interrogation_Position=932; Antisense; TAAGGATGCATGTCCCAGGGCCGCT
>probe:Drosophila_2:1624433_at:552:267; Interrogation_Position=947; Antisense; CAGGGCCGCTGGATTTATCAATACG
>probe:Drosophila_2:1624433_at:400:525; Interrogation_Position=972; Antisense; GGGCTATCTTGTCTATCCTGTAATA
>probe:Drosophila_2:1624433_at:726:553; Interrogation_Position=998; Antisense; TCCCAAAGTGGGTGTCGACGTCGGT

Paste this into a BLAST search page for me
GTCGGTCCTCAAACCATGGGACTATGGAACCTACCCTAATGGTGCGAGTAAACAACCTTGATCTGAGTGTCCTCTTTGCCCGAAGCTAATGACGCCATCTCTATGGCGTTCGTAATTCCTGTATATATAACTTACAGCTAGTCGCCATCCGAATACAACTCAAGGCTGTGTCCGTCTGTGTCCGTTAAGCCGCATATAAACAAAGCCCAGAGTGCAGCTGCAGTTAAACGATCAGCCATATCCGGTAGCCTAAGGATGCATGTCCCAGGGCCGCTCAGGGCCGCTGGATTTATCAATACGGGGCTATCTTGTCTATCCTGTAATATCCCAAAGTGGGTGTCGACGTCGGT

Full Affymetrix probeset data:

Annotations for 1624433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720