FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624434_at:

>probe:Drosophila_2:1624434_at:16:499; Interrogation_Position=2793; Antisense; GTCTCCGAATGTGGTGGCTACTTGA
>probe:Drosophila_2:1624434_at:168:165; Interrogation_Position=2825; Antisense; AAATCATTCACAGACCTTCTACTCG
>probe:Drosophila_2:1624434_at:607:145; Interrogation_Position=2845; Antisense; ACTCGCATCCACGATACGGCAGTAG
>probe:Drosophila_2:1624434_at:502:3; Interrogation_Position=2896; Antisense; ATTGGCGCATTCAGGCAGACCCGGA
>probe:Drosophila_2:1624434_at:222:207; Interrogation_Position=2921; Antisense; AAGCAGTGTCAAGATCCGTTTCCTA
>probe:Drosophila_2:1624434_at:36:305; Interrogation_Position=2936; Antisense; CCGTTTCCTACACTTCGAGATCGAG
>probe:Drosophila_2:1624434_at:585:669; Interrogation_Position=2961; Antisense; TACTCGGAGCGATGCGACTACGATT
>probe:Drosophila_2:1624434_at:464:95; Interrogation_Position=2992; Antisense; AGATCACCGAGGAGGGCTACTCAAT
>probe:Drosophila_2:1624434_at:601:385; Interrogation_Position=3017; Antisense; GAACACTATCCACGGCAGATTTTGC
>probe:Drosophila_2:1624434_at:139:493; Interrogation_Position=3112; Antisense; GTAACTCATTGAGAGGCTTCGCCAT
>probe:Drosophila_2:1624434_at:269:519; Interrogation_Position=3150; Antisense; GTGGATCCACCGGAAGATTCTGTTG
>probe:Drosophila_2:1624434_at:399:693; Interrogation_Position=3201; Antisense; TTTCCGGGCTATCTCAAGAGCATGT
>probe:Drosophila_2:1624434_at:529:481; Interrogation_Position=3224; Antisense; GTATTCCTCAGAAACGGGCAGCGAC
>probe:Drosophila_2:1624434_at:221:313; Interrogation_Position=3257; Antisense; GCCACCCAGCAGACTCATTTAGATA

Paste this into a BLAST search page for me
GTCTCCGAATGTGGTGGCTACTTGAAAATCATTCACAGACCTTCTACTCGACTCGCATCCACGATACGGCAGTAGATTGGCGCATTCAGGCAGACCCGGAAAGCAGTGTCAAGATCCGTTTCCTACCGTTTCCTACACTTCGAGATCGAGTACTCGGAGCGATGCGACTACGATTAGATCACCGAGGAGGGCTACTCAATGAACACTATCCACGGCAGATTTTGCGTAACTCATTGAGAGGCTTCGCCATGTGGATCCACCGGAAGATTCTGTTGTTTCCGGGCTATCTCAAGAGCATGTGTATTCCTCAGAAACGGGCAGCGACGCCACCCAGCAGACTCATTTAGATA

Full Affymetrix probeset data:

Annotations for 1624434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720