FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624435_at:

>probe:Drosophila_2:1624435_at:478:33; Interrogation_Position=1024; Antisense; ATCAACGACTGATGGCCGAGGATAC
>probe:Drosophila_2:1624435_at:152:437; Interrogation_Position=1041; Antisense; GAGGATACCCCTGCATGATTATTGA
>probe:Drosophila_2:1624435_at:71:371; Interrogation_Position=552; Antisense; GAAGGTGTCGTACAAGTATTCCATA
>probe:Drosophila_2:1624435_at:137:669; Interrogation_Position=577; Antisense; TACTACCTAATTTGCAGTGGCCTGG
>probe:Drosophila_2:1624435_at:239:51; Interrogation_Position=679; Antisense; ATGCGCGACCTCTTCGAGCGAAAGA
>probe:Drosophila_2:1624435_at:148:119; Interrogation_Position=695; Antisense; AGCGAAAGACCCACAGCGACGACAA
>probe:Drosophila_2:1624435_at:206:123; Interrogation_Position=709; Antisense; AGCGACGACAAGATGCAGCCAGTGC
>probe:Drosophila_2:1624435_at:59:413; Interrogation_Position=764; Antisense; GACCGCAGGACTACCTTCAGGAGGA
>probe:Drosophila_2:1624435_at:727:261; Interrogation_Position=867; Antisense; CACCAAGGCGGTAGCTACTCTGAGA
>probe:Drosophila_2:1624435_at:402:369; Interrogation_Position=890; Antisense; GAATGCAGGCGGAGCTCAACTACTA
>probe:Drosophila_2:1624435_at:278:193; Interrogation_Position=907; Antisense; AACTACTACAGCTGCATGGCGATCA
>probe:Drosophila_2:1624435_at:474:67; Interrogation_Position=922; Antisense; ATGGCGATCATTGCCCTCGAGTTTT
>probe:Drosophila_2:1624435_at:463:427; Interrogation_Position=940; Antisense; GAGTTTTTGGGCTTGTTCACCGCTT
>probe:Drosophila_2:1624435_at:469:711; Interrogation_Position=955; Antisense; TTCACCGCTTACCATTTGGGCAAGG

Paste this into a BLAST search page for me
ATCAACGACTGATGGCCGAGGATACGAGGATACCCCTGCATGATTATTGAGAAGGTGTCGTACAAGTATTCCATATACTACCTAATTTGCAGTGGCCTGGATGCGCGACCTCTTCGAGCGAAAGAAGCGAAAGACCCACAGCGACGACAAAGCGACGACAAGATGCAGCCAGTGCGACCGCAGGACTACCTTCAGGAGGACACCAAGGCGGTAGCTACTCTGAGAGAATGCAGGCGGAGCTCAACTACTAAACTACTACAGCTGCATGGCGATCAATGGCGATCATTGCCCTCGAGTTTTGAGTTTTTGGGCTTGTTCACCGCTTTTCACCGCTTACCATTTGGGCAAGG

Full Affymetrix probeset data:

Annotations for 1624435_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720