Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624437_s_at:

>probe:Drosophila_2:1624437_s_at:504:545; Interrogation_Position=187; Antisense; GGATCCATCTACTCCAGCAACGTCA
>probe:Drosophila_2:1624437_s_at:722:37; Interrogation_Position=193; Antisense; ATCTACTCCAGCAACGTCATCGTGA
>probe:Drosophila_2:1624437_s_at:261:643; Interrogation_Position=194; Antisense; TCTACTCCAGCAACGTCATCGTGAC
>probe:Drosophila_2:1624437_s_at:158:629; Interrogation_Position=199; Antisense; TCCAGCAACGTCATCGTGACCGCCG
>probe:Drosophila_2:1624437_s_at:469:117; Interrogation_Position=277; Antisense; AGCTACTGGAGCTCCGGCGGTGTCA
>probe:Drosophila_2:1624437_s_at:399:575; Interrogation_Position=292; Antisense; GGCGGTGTCACCTTCTCTGTGTCCT
>probe:Drosophila_2:1624437_s_at:505:275; Interrogation_Position=303; Antisense; CTTCTCTGTGTCCTCCTTCAAGAAC
>probe:Drosophila_2:1624437_s_at:149:597; Interrogation_Position=309; Antisense; TGTGTCCTCCTTCAAGAACCACGAG
>probe:Drosophila_2:1624437_s_at:622:537; Interrogation_Position=354; Antisense; GGTCAACGACATTGCCATCATCAAG
>probe:Drosophila_2:1624437_s_at:191:495; Interrogation_Position=355; Antisense; GTCAACGACATTGCCATCATCAAGA
>probe:Drosophila_2:1624437_s_at:444:149; Interrogation_Position=362; Antisense; ACATTGCCATCATCAAGATCAACGG
>probe:Drosophila_2:1624437_s_at:263:37; Interrogation_Position=370; Antisense; ATCATCAAGATCAACGGCGCCCTGA
>probe:Drosophila_2:1624437_s_at:592:645; Interrogation_Position=371; Antisense; TCATCAAGATCAACGGCGCCCTGAC
>probe:Drosophila_2:1624437_s_at:185:547; Interrogation_Position=469; Antisense; GGATGGGGCACTCTCTCCTACGGAT

Paste this into a BLAST search page for me
GGATCCATCTACTCCAGCAACGTCAATCTACTCCAGCAACGTCATCGTGATCTACTCCAGCAACGTCATCGTGACTCCAGCAACGTCATCGTGACCGCCGAGCTACTGGAGCTCCGGCGGTGTCAGGCGGTGTCACCTTCTCTGTGTCCTCTTCTCTGTGTCCTCCTTCAAGAACTGTGTCCTCCTTCAAGAACCACGAGGGTCAACGACATTGCCATCATCAAGGTCAACGACATTGCCATCATCAAGAACATTGCCATCATCAAGATCAACGGATCATCAAGATCAACGGCGCCCTGATCATCAAGATCAACGGCGCCCTGACGGATGGGGCACTCTCTCCTACGGAT

Full Affymetrix probeset data:

Annotations for 1624437_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime