FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624438_at:

>probe:Drosophila_2:1624438_at:715:635; Interrogation_Position=1028; Antisense; TCGAGTCACCGAACTATTGGCCTGT
>probe:Drosophila_2:1624438_at:615:571; Interrogation_Position=513; Antisense; GGCTGTACAACGAACCCGTGGTGAA
>probe:Drosophila_2:1624438_at:432:9; Interrogation_Position=550; Antisense; ATTCCACTTCGATCCCAATGATTAC
>probe:Drosophila_2:1624438_at:710:461; Interrogation_Position=569; Antisense; GATTACTTTACCAACACGGTGCTGA
>probe:Drosophila_2:1624438_at:323:535; Interrogation_Position=586; Antisense; GGTGCTGACCAAGACATATTTCCTC
>probe:Drosophila_2:1624438_at:376:105; Interrogation_Position=628; Antisense; AGACGATCCGCTCGCATATGATGGC
>probe:Drosophila_2:1624438_at:91:681; Interrogation_Position=644; Antisense; TATGATGGCGCCGAGATCTACAAGT
>probe:Drosophila_2:1624438_at:104:227; Interrogation_Position=672; Antisense; AAGGCTGCGTCATCGACTGGAAGCA
>probe:Drosophila_2:1624438_at:480:101; Interrogation_Position=727; Antisense; AGAGCCGTCGTTCTTTGAGTTCTTC
>probe:Drosophila_2:1624438_at:672:701; Interrogation_Position=762; Antisense; TTTTGCCAGAAGATACCCTTGACCC
>probe:Drosophila_2:1624438_at:274:143; Interrogation_Position=792; Antisense; ACTGTGACGTCAATGCTATGCTGCA
>probe:Drosophila_2:1624438_at:549:329; Interrogation_Position=852; Antisense; GCGTGATTCCCAAGGCGGTGATCTT
>probe:Drosophila_2:1624438_at:162:513; Interrogation_Position=869; Antisense; GTGATCTTCTTCACCGGCGAGATTG
>probe:Drosophila_2:1624438_at:112:465; Interrogation_Position=889; Antisense; GATTGCCGATTGTCAGAGCTCCAGC

Paste this into a BLAST search page for me
TCGAGTCACCGAACTATTGGCCTGTGGCTGTACAACGAACCCGTGGTGAAATTCCACTTCGATCCCAATGATTACGATTACTTTACCAACACGGTGCTGAGGTGCTGACCAAGACATATTTCCTCAGACGATCCGCTCGCATATGATGGCTATGATGGCGCCGAGATCTACAAGTAAGGCTGCGTCATCGACTGGAAGCAAGAGCCGTCGTTCTTTGAGTTCTTCTTTTGCCAGAAGATACCCTTGACCCACTGTGACGTCAATGCTATGCTGCAGCGTGATTCCCAAGGCGGTGATCTTGTGATCTTCTTCACCGGCGAGATTGGATTGCCGATTGTCAGAGCTCCAGC

Full Affymetrix probeset data:

Annotations for 1624438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720