Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624439_at:

>probe:Drosophila_2:1624439_at:611:149; Interrogation_Position=1165; Antisense; ACTTCTGCTGGACTCTTTGGCGAGG
>probe:Drosophila_2:1624439_at:123:501; Interrogation_Position=1210; Antisense; GTCGGAGCCTCTGTCAAGGCTGTGA
>probe:Drosophila_2:1624439_at:184:597; Interrogation_Position=1230; Antisense; TGTGAATGCCAGCTACTCGGACGCT
>probe:Drosophila_2:1624439_at:413:287; Interrogation_Position=1253; Antisense; CTGGTCTGTTCGGTTTTGTGGTCTC
>probe:Drosophila_2:1624439_at:78:615; Interrogation_Position=1328; Antisense; TGAAGTCGGCTTCGGTGTCTGATAA
>probe:Drosophila_2:1624439_at:519:441; Interrogation_Position=1354; Antisense; GATGTGGCCAGAGGCAAGGCTCTTC
>probe:Drosophila_2:1624439_at:637:71; Interrogation_Position=1370; Antisense; AGGCTCTTCTGAAGGCGCGCATCAT
>probe:Drosophila_2:1624439_at:368:279; Interrogation_Position=1401; Antisense; CTACTCGTCGGACGGTGGTCTAATT
>probe:Drosophila_2:1624439_at:566:653; Interrogation_Position=1421; Antisense; TAATTAAGGAGATCGGTCGCCAGGC
>probe:Drosophila_2:1624439_at:102:619; Interrogation_Position=1481; Antisense; TGCTTGGCGCAATCGATGGCATCTC
>probe:Drosophila_2:1624439_at:112:347; Interrogation_Position=1499; Antisense; GCATCTCGCAGTCGCAGGTCCAGGA
>probe:Drosophila_2:1624439_at:270:279; Interrogation_Position=1590; Antisense; CTACGCCTCCGATTTGGCTTAAGTA
>probe:Drosophila_2:1624439_at:209:133; Interrogation_Position=1620; Antisense; ACACCTGTACATCTGTTAACCGTAA
>probe:Drosophila_2:1624439_at:398:545; Interrogation_Position=1673; Antisense; GGATCGATCCGCGAACGTAAATACT

Paste this into a BLAST search page for me
ACTTCTGCTGGACTCTTTGGCGAGGGTCGGAGCCTCTGTCAAGGCTGTGATGTGAATGCCAGCTACTCGGACGCTCTGGTCTGTTCGGTTTTGTGGTCTCTGAAGTCGGCTTCGGTGTCTGATAAGATGTGGCCAGAGGCAAGGCTCTTCAGGCTCTTCTGAAGGCGCGCATCATCTACTCGTCGGACGGTGGTCTAATTTAATTAAGGAGATCGGTCGCCAGGCTGCTTGGCGCAATCGATGGCATCTCGCATCTCGCAGTCGCAGGTCCAGGACTACGCCTCCGATTTGGCTTAAGTAACACCTGTACATCTGTTAACCGTAAGGATCGATCCGCGAACGTAAATACT

Full Affymetrix probeset data:

Annotations for 1624439_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime