Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624442_at:

>probe:Drosophila_2:1624442_at:261:17; Interrogation_Position=1094; Antisense; ATTTTTCTTCGCCAATTCATACAAG
>probe:Drosophila_2:1624442_at:392:217; Interrogation_Position=1116; Antisense; AAGTTCATCAACTTCTTCTGGGCTT
>probe:Drosophila_2:1624442_at:116:645; Interrogation_Position=1129; Antisense; TCTTCTGGGCTTGGAATATGCGGAA
>probe:Drosophila_2:1624442_at:366:523; Interrogation_Position=1160; Antisense; GGGCTCCAGGTGGACCAAATGGTCC
>probe:Drosophila_2:1624442_at:355:257; Interrogation_Position=1175; Antisense; CAAATGGTCCAGGAGGTCCCATGGG
>probe:Drosophila_2:1624442_at:467:255; Interrogation_Position=1430; Antisense; CAAAAGCTAAGCATTGGGCCCCAAA
>probe:Drosophila_2:1624442_at:98:729; Interrogation_Position=1443; Antisense; TTGGGCCCCAAAACATACACATCAT
>probe:Drosophila_2:1624442_at:725:63; Interrogation_Position=1472; Antisense; ATGGAGACCCCATCACCTTACCAAT
>probe:Drosophila_2:1624442_at:265:277; Interrogation_Position=1488; Antisense; CTTACCAATTGGTCCACCTGAAATA
>probe:Drosophila_2:1624442_at:452:179; Interrogation_Position=1512; Antisense; AAAACAGTTTAGAATGCGGCCAATA
>probe:Drosophila_2:1624442_at:450:331; Interrogation_Position=1527; Antisense; GCGGCCAATAGAGGCGGATACATTC
>probe:Drosophila_2:1624442_at:397:543; Interrogation_Position=1542; Antisense; GGATACATTCAAGCTACGTGATCAA
>probe:Drosophila_2:1624442_at:393:659; Interrogation_Position=1583; Antisense; TAAGCCCAAGAAGTAATCTCCCAAT
>probe:Drosophila_2:1624442_at:664:355; Interrogation_Position=1642; Antisense; GCACATATTCTTAACTCTTTCAATG

Paste this into a BLAST search page for me
ATTTTTCTTCGCCAATTCATACAAGAAGTTCATCAACTTCTTCTGGGCTTTCTTCTGGGCTTGGAATATGCGGAAGGGCTCCAGGTGGACCAAATGGTCCCAAATGGTCCAGGAGGTCCCATGGGCAAAAGCTAAGCATTGGGCCCCAAATTGGGCCCCAAAACATACACATCATATGGAGACCCCATCACCTTACCAATCTTACCAATTGGTCCACCTGAAATAAAAACAGTTTAGAATGCGGCCAATAGCGGCCAATAGAGGCGGATACATTCGGATACATTCAAGCTACGTGATCAATAAGCCCAAGAAGTAATCTCCCAATGCACATATTCTTAACTCTTTCAATG

Full Affymetrix probeset data:

Annotations for 1624442_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime