FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624448_at:

>probe:Drosophila_2:1624448_at:334:77; Interrogation_Position=1730; Antisense; AGGATGATCTTTGCCTCGTATTTCA
>probe:Drosophila_2:1624448_at:710:685; Interrogation_Position=1748; Antisense; TATTTCATGTTCTGTGTCACTTCGC
>probe:Drosophila_2:1624448_at:40:515; Interrogation_Position=1761; Antisense; GTGTCACTTCGCTGAGTTACTATGT
>probe:Drosophila_2:1624448_at:407:475; Interrogation_Position=1776; Antisense; GTTACTATGTGACGGCTCTCAATGC
>probe:Drosophila_2:1624448_at:42:233; Interrogation_Position=1796; Antisense; AATGCCGCCAATTTGTCGGTGTCCA
>probe:Drosophila_2:1624448_at:326:501; Interrogation_Position=1810; Antisense; GTCGGTGTCCAGATACCTATACATT
>probe:Drosophila_2:1624448_at:246:289; Interrogation_Position=1843; Antisense; CGGTCTGGTGGATATACCCTCCTAT
>probe:Drosophila_2:1624448_at:553:503; Interrogation_Position=1871; Antisense; GTCCCTGTGATAATGCTGCGCTTTA
>probe:Drosophila_2:1624448_at:648:417; Interrogation_Position=2060; Antisense; GAGCTGTATCCCACCCAGATAAGAA
>probe:Drosophila_2:1624448_at:691:97; Interrogation_Position=2081; Antisense; AGAAACTCGGCTTTGGGAACCTGCT
>probe:Drosophila_2:1624448_at:172:131; Interrogation_Position=2137; Antisense; ACCGTATGTGGTCGATGTCCTTGGA
>probe:Drosophila_2:1624448_at:222:553; Interrogation_Position=2159; Antisense; GGAGCTCTGGGCTGGTACATTCCAA
>probe:Drosophila_2:1624448_at:193:719; Interrogation_Position=2178; Antisense; TTCCAACAACGATTTGCGGCTGCTG
>probe:Drosophila_2:1624448_at:394:621; Interrogation_Position=2198; Antisense; TGCTGCGTTCTAGTAGCTGGCCTAC

Paste this into a BLAST search page for me
AGGATGATCTTTGCCTCGTATTTCATATTTCATGTTCTGTGTCACTTCGCGTGTCACTTCGCTGAGTTACTATGTGTTACTATGTGACGGCTCTCAATGCAATGCCGCCAATTTGTCGGTGTCCAGTCGGTGTCCAGATACCTATACATTCGGTCTGGTGGATATACCCTCCTATGTCCCTGTGATAATGCTGCGCTTTAGAGCTGTATCCCACCCAGATAAGAAAGAAACTCGGCTTTGGGAACCTGCTACCGTATGTGGTCGATGTCCTTGGAGGAGCTCTGGGCTGGTACATTCCAATTCCAACAACGATTTGCGGCTGCTGTGCTGCGTTCTAGTAGCTGGCCTAC

Full Affymetrix probeset data:

Annotations for 1624448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720