Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624449_at:

>probe:Drosophila_2:1624449_at:712:53; Interrogation_Position=13; Antisense; ATGCAAACGGCAGAGCGCAATTCAA
>probe:Drosophila_2:1624449_at:394:357; Interrogation_Position=15; Antisense; GCAAACGGCAGAGCGCAATTCAAGA
>probe:Drosophila_2:1624449_at:580:111; Interrogation_Position=173; Antisense; AGCAACTCTACGAACAGCAGCAGGC
>probe:Drosophila_2:1624449_at:102:255; Interrogation_Position=175; Antisense; CAACTCTACGAACAGCAGCAGGCTT
>probe:Drosophila_2:1624449_at:319:643; Interrogation_Position=179; Antisense; TCTACGAACAGCAGCAGGCTTGGCT
>probe:Drosophila_2:1624449_at:203:197; Interrogation_Position=18; Antisense; AACGGCAGAGCGCAATTCAAGAGTA
>probe:Drosophila_2:1624449_at:174:137; Interrogation_Position=182; Antisense; ACGAACAGCAGCAGGCTTGGCTCTA
>probe:Drosophila_2:1624449_at:429:567; Interrogation_Position=21; Antisense; GGCAGAGCGCAATTCAAGAGTAAAC
>probe:Drosophila_2:1624449_at:474:245; Interrogation_Position=31; Antisense; AATTCAAGAGTAAACTGCTCCTCGA
>probe:Drosophila_2:1624449_at:361:181; Interrogation_Position=36; Antisense; AAGAGTAAACTGCTCCTCGAACCCG
>probe:Drosophila_2:1624449_at:191:101; Interrogation_Position=37; Antisense; AGAGTAAACTGCTCCTCGAACCCGC
>probe:Drosophila_2:1624449_at:155:323; Interrogation_Position=63; Antisense; GCCCACTGCATTCTGCAAACTTTGG
>probe:Drosophila_2:1624449_at:169:145; Interrogation_Position=67; Antisense; ACTGCATTCTGCAAACTTTGGTTGC
>probe:Drosophila_2:1624449_at:334:615; Interrogation_Position=76; Antisense; TGCAAACTTTGGTTGCAGCAACAGC

Paste this into a BLAST search page for me
ATGCAAACGGCAGAGCGCAATTCAAGCAAACGGCAGAGCGCAATTCAAGAAGCAACTCTACGAACAGCAGCAGGCCAACTCTACGAACAGCAGCAGGCTTTCTACGAACAGCAGCAGGCTTGGCTAACGGCAGAGCGCAATTCAAGAGTAACGAACAGCAGCAGGCTTGGCTCTAGGCAGAGCGCAATTCAAGAGTAAACAATTCAAGAGTAAACTGCTCCTCGAAAGAGTAAACTGCTCCTCGAACCCGAGAGTAAACTGCTCCTCGAACCCGCGCCCACTGCATTCTGCAAACTTTGGACTGCATTCTGCAAACTTTGGTTGCTGCAAACTTTGGTTGCAGCAACAGC

Full Affymetrix probeset data:

Annotations for 1624449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime