Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624450_at:

>probe:Drosophila_2:1624450_at:397:615; Interrogation_Position=1950; Antisense; TGAATTGGCTGATCGTTGCCTGCGC
>probe:Drosophila_2:1624450_at:389:701; Interrogation_Position=1995; Antisense; TTACCTCGTCGTATGGAACCATCTA
>probe:Drosophila_2:1624450_at:300:189; Interrogation_Position=2034; Antisense; AACAGTTCCCGACTGTGGTGCGGAA
>probe:Drosophila_2:1624450_at:107:371; Interrogation_Position=2056; Antisense; GAATGTGGGTCTGGGAGCCTCCTCC
>probe:Drosophila_2:1624450_at:349:177; Interrogation_Position=2120; Antisense; AAACTGCTGGGCGAGATCTGGCGAC
>probe:Drosophila_2:1624450_at:339:605; Interrogation_Position=2154; Antisense; TGATCATCTGCGGAGCACTGTCTCT
>probe:Drosophila_2:1624450_at:61:337; Interrogation_Position=2200; Antisense; GCTCTTGCCGGAGACCCTTAACAAA
>probe:Drosophila_2:1624450_at:684:707; Interrogation_Position=2217; Antisense; TTAACAAACCCATGCCGGAGACCAT
>probe:Drosophila_2:1624450_at:68:327; Interrogation_Position=2359; Antisense; GCGAGACGACGAGCAGTTAATCACT
>probe:Drosophila_2:1624450_at:178:147; Interrogation_Position=2381; Antisense; ACTCAATCTACACTGATGGCCTCAA
>probe:Drosophila_2:1624450_at:131:441; Interrogation_Position=2395; Antisense; GATGGCCTCAATTGGTCATTTCAAC
>probe:Drosophila_2:1624450_at:694:17; Interrogation_Position=2422; Antisense; ATTTAAGCATTCAGCGCACTTCCAT
>probe:Drosophila_2:1624450_at:434:149; Interrogation_Position=2439; Antisense; ACTTCCATTTCTCCAGCGATGTATA
>probe:Drosophila_2:1624450_at:626:245; Interrogation_Position=2470; Antisense; AATTCATTCCATTTTCTCAGCTCTA

Paste this into a BLAST search page for me
TGAATTGGCTGATCGTTGCCTGCGCTTACCTCGTCGTATGGAACCATCTAAACAGTTCCCGACTGTGGTGCGGAAGAATGTGGGTCTGGGAGCCTCCTCCAAACTGCTGGGCGAGATCTGGCGACTGATCATCTGCGGAGCACTGTCTCTGCTCTTGCCGGAGACCCTTAACAAATTAACAAACCCATGCCGGAGACCATGCGAGACGACGAGCAGTTAATCACTACTCAATCTACACTGATGGCCTCAAGATGGCCTCAATTGGTCATTTCAACATTTAAGCATTCAGCGCACTTCCATACTTCCATTTCTCCAGCGATGTATAAATTCATTCCATTTTCTCAGCTCTA

Full Affymetrix probeset data:

Annotations for 1624450_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime