FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624454_at:

>probe:Drosophila_2:1624454_at:76:699; Interrogation_Position=1012; Antisense; TTGTGGCCGTTGGTCTGAAGGTAAT
>probe:Drosophila_2:1624454_at:570:135; Interrogation_Position=1086; Antisense; ACGCAACGCTTTAGGCAGGCCATGA
>probe:Drosophila_2:1624454_at:61:71; Interrogation_Position=1102; Antisense; AGGCCATGACAAAGGCTGGATTCAC
>probe:Drosophila_2:1624454_at:261:589; Interrogation_Position=1118; Antisense; TGGATTCACCATAGCCGGCGAGAAC
>probe:Drosophila_2:1624454_at:317:39; Interrogation_Position=1149; Antisense; ATCTGCCCCGTTATGCTAGGTGACG
>probe:Drosophila_2:1624454_at:273:721; Interrogation_Position=1180; Antisense; TTGCCTCCCAGTTTGCCGATGAGAT
>probe:Drosophila_2:1624454_at:32:723; Interrogation_Position=1192; Antisense; TTGCCGATGAGATGCTAACCCGTGG
>probe:Drosophila_2:1624454_at:115:661; Interrogation_Position=1207; Antisense; TAACCCGTGGCATCTATGTCATCGG
>probe:Drosophila_2:1624454_at:629:113; Interrogation_Position=1236; Antisense; AGCTATCCGGTGGTTCCTCAGGGAA
>probe:Drosophila_2:1624454_at:45:395; Interrogation_Position=1258; Antisense; GAAAGGCACGCATCCGTGTTCAAAT
>probe:Drosophila_2:1624454_at:202:619; Interrogation_Position=1325; Antisense; TGCATTCATTGAAGTCGGTCGCTCT
>probe:Drosophila_2:1624454_at:285:501; Interrogation_Position=1338; Antisense; GTCGGTCGCTCTCTGAAAGTAATCA
>probe:Drosophila_2:1624454_at:482:663; Interrogation_Position=883; Antisense; TAAACTCCACACTGGGCAAGGCTTT
>probe:Drosophila_2:1624454_at:434:509; Interrogation_Position=913; Antisense; GTGCTTCCGGTGGATACACCACTGG

Paste this into a BLAST search page for me
TTGTGGCCGTTGGTCTGAAGGTAATACGCAACGCTTTAGGCAGGCCATGAAGGCCATGACAAAGGCTGGATTCACTGGATTCACCATAGCCGGCGAGAACATCTGCCCCGTTATGCTAGGTGACGTTGCCTCCCAGTTTGCCGATGAGATTTGCCGATGAGATGCTAACCCGTGGTAACCCGTGGCATCTATGTCATCGGAGCTATCCGGTGGTTCCTCAGGGAAGAAAGGCACGCATCCGTGTTCAAATTGCATTCATTGAAGTCGGTCGCTCTGTCGGTCGCTCTCTGAAAGTAATCATAAACTCCACACTGGGCAAGGCTTTGTGCTTCCGGTGGATACACCACTGG

Full Affymetrix probeset data:

Annotations for 1624454_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720