FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624457_at:

>probe:Drosophila_2:1624457_at:670:533; Interrogation_Position=308; Antisense; GGTGTGCCACTATTGGTACCAACAT
>probe:Drosophila_2:1624457_at:587:585; Interrogation_Position=334; Antisense; TGGACTACTTGTTTCCGAAGCGCAC
>probe:Drosophila_2:1624457_at:419:693; Interrogation_Position=383; Antisense; TTTGCTGGACCAGTTCATCTGCTCA
>probe:Drosophila_2:1624457_at:425:701; Interrogation_Position=411; Antisense; TTTTACATCGCCGTATTCTTTCTCA
>probe:Drosophila_2:1624457_at:149:11; Interrogation_Position=425; Antisense; ATTCTTTCTCACAATGGCCATTCTG
>probe:Drosophila_2:1624457_at:27:423; Interrogation_Position=489; Antisense; GAGAAGGCCTTAGTACTGTACGCTG
>probe:Drosophila_2:1624457_at:15:669; Interrogation_Position=502; Antisense; TACTGTACGCTGCTGAGTGGACCGT
>probe:Drosophila_2:1624457_at:203:523; Interrogation_Position=527; Antisense; GTGGCCATTGGCACAGTTCATCAAC
>probe:Drosophila_2:1624457_at:708:191; Interrogation_Position=549; Antisense; AACTTTCTGCTGATCAAGCCGCAAT
>probe:Drosophila_2:1624457_at:290:187; Interrogation_Position=591; Antisense; AACACCATCAGTTTGGGCTACGATA
>probe:Drosophila_2:1624457_at:618:523; Interrogation_Position=605; Antisense; GGGCTACGATATCTATACGTCTCAA
>probe:Drosophila_2:1624457_at:326:65; Interrogation_Position=718; Antisense; ATGGTTGTCTACTGTTCTGGACTGC
>probe:Drosophila_2:1624457_at:677:461; Interrogation_Position=731; Antisense; GTTCTGGACTGCCACTGCAAATCAT
>probe:Drosophila_2:1624457_at:432:599; Interrogation_Position=777; Antisense; TGTCATTCCAATGCCTTAGATCCTG

Paste this into a BLAST search page for me
GGTGTGCCACTATTGGTACCAACATTGGACTACTTGTTTCCGAAGCGCACTTTGCTGGACCAGTTCATCTGCTCATTTTACATCGCCGTATTCTTTCTCAATTCTTTCTCACAATGGCCATTCTGGAGAAGGCCTTAGTACTGTACGCTGTACTGTACGCTGCTGAGTGGACCGTGTGGCCATTGGCACAGTTCATCAACAACTTTCTGCTGATCAAGCCGCAATAACACCATCAGTTTGGGCTACGATAGGGCTACGATATCTATACGTCTCAAATGGTTGTCTACTGTTCTGGACTGCGTTCTGGACTGCCACTGCAAATCATTGTCATTCCAATGCCTTAGATCCTG

Full Affymetrix probeset data:

Annotations for 1624457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720