FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624458_at:

>probe:Drosophila_2:1624458_at:173:5; Interrogation_Position=1032; Antisense; ATTGGACTGCAATGGGCGTTTTATG
>probe:Drosophila_2:1624458_at:222:55; Interrogation_Position=1060; Antisense; ATGAAGGCGGCCTATGGACATCCTC
>probe:Drosophila_2:1624458_at:94:631; Interrogation_Position=1080; Antisense; TCCTCATCATCCATTTGAACCCAAA
>probe:Drosophila_2:1624458_at:233:485; Interrogation_Position=1190; Antisense; GTATGCGGCGATCTGCAGAGTTATA
>probe:Drosophila_2:1624458_at:418:505; Interrogation_Position=1223; Antisense; GTCCAGGTACTTCCTTTATACTGAG
>probe:Drosophila_2:1624458_at:721:203; Interrogation_Position=736; Antisense; AAGCCATTGATTACGCTGTGCTATG
>probe:Drosophila_2:1624458_at:73:157; Interrogation_Position=785; Antisense; ACAGCTGCCTGGGATCGGGACATAC
>probe:Drosophila_2:1624458_at:149:449; Interrogation_Position=797; Antisense; GATCGGGACATACGCCCTACGAGAA
>probe:Drosophila_2:1624458_at:26:47; Interrogation_Position=848; Antisense; ATCCGACCATCTTGGCTATAGCTGA
>probe:Drosophila_2:1624458_at:529:225; Interrogation_Position=882; Antisense; AAGGACTGCGGCACAGGTGCTCCTA
>probe:Drosophila_2:1624458_at:81:631; Interrogation_Position=902; Antisense; TCCTACGCTTTCAGACACAATCGGG
>probe:Drosophila_2:1624458_at:333:539; Interrogation_Position=925; Antisense; GGTATAATTGTCATCCCAAGATCAG
>probe:Drosophila_2:1624458_at:217:367; Interrogation_Position=983; Antisense; GAATCTGGGACTTTGAGTTGGCCGT
>probe:Drosophila_2:1624458_at:41:419; Interrogation_Position=997; Antisense; GAGTTGGCCGTCGATGACATACAGG

Paste this into a BLAST search page for me
ATTGGACTGCAATGGGCGTTTTATGATGAAGGCGGCCTATGGACATCCTCTCCTCATCATCCATTTGAACCCAAAGTATGCGGCGATCTGCAGAGTTATAGTCCAGGTACTTCCTTTATACTGAGAAGCCATTGATTACGCTGTGCTATGACAGCTGCCTGGGATCGGGACATACGATCGGGACATACGCCCTACGAGAAATCCGACCATCTTGGCTATAGCTGAAAGGACTGCGGCACAGGTGCTCCTATCCTACGCTTTCAGACACAATCGGGGGTATAATTGTCATCCCAAGATCAGGAATCTGGGACTTTGAGTTGGCCGTGAGTTGGCCGTCGATGACATACAGG

Full Affymetrix probeset data:

Annotations for 1624458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720