FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624459_at:

>probe:Drosophila_2:1624459_at:103:459; Interrogation_Position=1031; Antisense; GATATCTGCCGCTGATAAGTCCGGA
>probe:Drosophila_2:1624459_at:270:539; Interrogation_Position=1084; Antisense; GGTACCGGCATCTCATCCTACGGAT
>probe:Drosophila_2:1624459_at:546:51; Interrogation_Position=1107; Antisense; ATGCGTCAAGTCAGAGAAGTCCTCA
>probe:Drosophila_2:1624459_at:308:373; Interrogation_Position=1122; Antisense; GAAGTCCTCACCAAATGCGGTAGTG
>probe:Drosophila_2:1624459_at:187:187; Interrogation_Position=610; Antisense; AACAAGTCACCGGTGCCAGGTGGTG
>probe:Drosophila_2:1624459_at:173:583; Interrogation_Position=654; Antisense; TGGTGCCAACGGTGGTGTCAACGCT
>probe:Drosophila_2:1624459_at:492:651; Interrogation_Position=671; Antisense; TCAACGCTGGTGGTGCGGGTAACTC
>probe:Drosophila_2:1624459_at:431:83; Interrogation_Position=703; Antisense; AGTGGCCCAGGATCAGTTGGCTCCC
>probe:Drosophila_2:1624459_at:580:309; Interrogation_Position=728; Antisense; CCAAGGATATGCAGCCCCAGTTGTC
>probe:Drosophila_2:1624459_at:62:95; Interrogation_Position=746; Antisense; AGTTGTCGCCCTTGGGTCAGTCGCT
>probe:Drosophila_2:1624459_at:147:355; Interrogation_Position=792; Antisense; GCACCAGTCACCATATCAATCGCAT
>probe:Drosophila_2:1624459_at:388:261; Interrogation_Position=864; Antisense; CACCTTGAGCGCCAAGTACGGTTTT
>probe:Drosophila_2:1624459_at:466:249; Interrogation_Position=876; Antisense; CAAGTACGGTTTTGGTTCGCCACTG
>probe:Drosophila_2:1624459_at:525:539; Interrogation_Position=889; Antisense; GGTTCGCCACTGGAGTTATCGCTGC

Paste this into a BLAST search page for me
GATATCTGCCGCTGATAAGTCCGGAGGTACCGGCATCTCATCCTACGGATATGCGTCAAGTCAGAGAAGTCCTCAGAAGTCCTCACCAAATGCGGTAGTGAACAAGTCACCGGTGCCAGGTGGTGTGGTGCCAACGGTGGTGTCAACGCTTCAACGCTGGTGGTGCGGGTAACTCAGTGGCCCAGGATCAGTTGGCTCCCCCAAGGATATGCAGCCCCAGTTGTCAGTTGTCGCCCTTGGGTCAGTCGCTGCACCAGTCACCATATCAATCGCATCACCTTGAGCGCCAAGTACGGTTTTCAAGTACGGTTTTGGTTCGCCACTGGGTTCGCCACTGGAGTTATCGCTGC

Full Affymetrix probeset data:

Annotations for 1624459_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720