Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624460_s_at:

>probe:Drosophila_2:1624460_s_at:62:71; Interrogation_Position=123; Antisense; AGGCCATCACCAAGCGTATGATCAC
>probe:Drosophila_2:1624460_s_at:509:719; Interrogation_Position=179; Antisense; TTCCTGTGCCACCACTGCGATGAGC
>probe:Drosophila_2:1624460_s_at:151:57; Interrogation_Position=198; Antisense; ATGAGCAGATCCTGGATGCCACCTT
>probe:Drosophila_2:1624460_s_at:520:627; Interrogation_Position=214; Antisense; TGCCACCTTCAATGTTCAGAGCGGA
>probe:Drosophila_2:1624460_s_at:371:203; Interrogation_Position=240; Antisense; AACCAGTGTGCAACAAGTGCTTCGT
>probe:Drosophila_2:1624460_s_at:102:85; Interrogation_Position=255; Antisense; AGTGCTTCGTGGAGCGGTACACCTA
>probe:Drosophila_2:1624460_s_at:681:629; Interrogation_Position=306; Antisense; TCCTTGAAAAAACCATCTGCGCCAT
>probe:Drosophila_2:1624460_s_at:329:177; Interrogation_Position=396; Antisense; AAACGTTCTATGAGCGCGACGGCAA
>probe:Drosophila_2:1624460_s_at:389:323; Interrogation_Position=409; Antisense; GCGCGACGGCAAGCCCTATTGCAAA
>probe:Drosophila_2:1624460_s_at:347:721; Interrogation_Position=453; Antisense; TTGCTGCCAGGTGCGCCAAGTGCGA
>probe:Drosophila_2:1624460_s_at:629:203; Interrogation_Position=479; Antisense; AAGCCTATAACGGACTCAGCGGTGC
>probe:Drosophila_2:1624460_s_at:722:329; Interrogation_Position=497; Antisense; GCGGTGCTCGCCATGAACGTGAAGT
>probe:Drosophila_2:1624460_s_at:606:109; Interrogation_Position=555; Antisense; AGAATCCTATAACCTCGCAGACTTT
>probe:Drosophila_2:1624460_s_at:647:283; Interrogation_Position=613; Antisense; CTGCAATTGCTAACATCGTCCCGGA

Paste this into a BLAST search page for me
AGGCCATCACCAAGCGTATGATCACTTCCTGTGCCACCACTGCGATGAGCATGAGCAGATCCTGGATGCCACCTTTGCCACCTTCAATGTTCAGAGCGGAAACCAGTGTGCAACAAGTGCTTCGTAGTGCTTCGTGGAGCGGTACACCTATCCTTGAAAAAACCATCTGCGCCATAAACGTTCTATGAGCGCGACGGCAAGCGCGACGGCAAGCCCTATTGCAAATTGCTGCCAGGTGCGCCAAGTGCGAAAGCCTATAACGGACTCAGCGGTGCGCGGTGCTCGCCATGAACGTGAAGTAGAATCCTATAACCTCGCAGACTTTCTGCAATTGCTAACATCGTCCCGGA

Full Affymetrix probeset data:

Annotations for 1624460_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime