Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624465_at:

>probe:Drosophila_2:1624465_at:102:443; Interrogation_Position=4736; Antisense; GATGTCTCGCATCGAGGATCATGAG
>probe:Drosophila_2:1624465_at:428:361; Interrogation_Position=4760; Antisense; GAATTCGCATAGCAGGGACTCGGCA
>probe:Drosophila_2:1624465_at:328:403; Interrogation_Position=4776; Antisense; GACTCGGCAGTTGATGATTCGGTTG
>probe:Drosophila_2:1624465_at:427:9; Interrogation_Position=4804; Antisense; ATTCGGTGGAGGTCACCACTGTGAC
>probe:Drosophila_2:1624465_at:220:595; Interrogation_Position=4823; Antisense; TGTGACGCCTTCTCATGAGCCCAAG
>probe:Drosophila_2:1624465_at:141:301; Interrogation_Position=4842; Antisense; CCCAAGCACGGCGAGCTGTGATGAA
>probe:Drosophila_2:1624465_at:451:667; Interrogation_Position=4924; Antisense; TACTTAGCTAAGAGCCATCTCCGAA
>probe:Drosophila_2:1624465_at:178:197; Interrogation_Position=5068; Antisense; AACGATTTTCTTGTCTTGCATTCCA
>probe:Drosophila_2:1624465_at:349:273; Interrogation_Position=5082; Antisense; CTTGCATTCCAAGAGCTACTAATTA
>probe:Drosophila_2:1624465_at:386:599; Interrogation_Position=5125; Antisense; TGTCATCATACTAAATACGCGCCTT
>probe:Drosophila_2:1624465_at:630:25; Interrogation_Position=5139; Antisense; ATACGCGCCTTTAAGTTGAAGATTG
>probe:Drosophila_2:1624465_at:547:7; Interrogation_Position=5224; Antisense; ATTTGGGATGGTCAGGCCACTTTAC
>probe:Drosophila_2:1624465_at:242:273; Interrogation_Position=5252; Antisense; CTCGAAAAGCTTTGGTGACTGCGTA
>probe:Drosophila_2:1624465_at:4:285; Interrogation_Position=5270; Antisense; CTGCGTATGTGCGTTAGGTGGCAAC

Paste this into a BLAST search page for me
GATGTCTCGCATCGAGGATCATGAGGAATTCGCATAGCAGGGACTCGGCAGACTCGGCAGTTGATGATTCGGTTGATTCGGTGGAGGTCACCACTGTGACTGTGACGCCTTCTCATGAGCCCAAGCCCAAGCACGGCGAGCTGTGATGAATACTTAGCTAAGAGCCATCTCCGAAAACGATTTTCTTGTCTTGCATTCCACTTGCATTCCAAGAGCTACTAATTATGTCATCATACTAAATACGCGCCTTATACGCGCCTTTAAGTTGAAGATTGATTTGGGATGGTCAGGCCACTTTACCTCGAAAAGCTTTGGTGACTGCGTACTGCGTATGTGCGTTAGGTGGCAAC

Full Affymetrix probeset data:

Annotations for 1624465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime