Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624468_a_at:

>probe:Drosophila_2:1624468_a_at:103:29; Interrogation_Position=1001; Antisense; ATACGCTCTGGTTGGATATGCTGAA
>probe:Drosophila_2:1624468_a_at:447:529; Interrogation_Position=1071; Antisense; GGGATTCATCTTTGACTAGGCTTCA
>probe:Drosophila_2:1624468_a_at:610:131; Interrogation_Position=622; Antisense; ACCGTCGACGATATATTTCGCGCCA
>probe:Drosophila_2:1624468_a_at:705:559; Interrogation_Position=675; Antisense; GGAACCCATCTCACAGATTGTCGGA
>probe:Drosophila_2:1624468_a_at:350:21; Interrogation_Position=709; Antisense; ATATTCGATCTGAAGGACCTGGGCT
>probe:Drosophila_2:1624468_a_at:697:553; Interrogation_Position=723; Antisense; GGACCTGGGCTTGGAACACATACTC
>probe:Drosophila_2:1624468_a_at:432:431; Interrogation_Position=753; Antisense; GAGTCCCAGCGTGGCTCAGAAGATG
>probe:Drosophila_2:1624468_a_at:72:59; Interrogation_Position=775; Antisense; ATGATTGCTCTACTAGTGACCTCCA
>probe:Drosophila_2:1624468_a_at:689:385; Interrogation_Position=809; Antisense; GAACATCCGCCCTTCATATTGTAAA
>probe:Drosophila_2:1624468_a_at:230:109; Interrogation_Position=836; Antisense; AGAATTGGGTCTTCAACGCGGCATT
>probe:Drosophila_2:1624468_a_at:440:67; Interrogation_Position=914; Antisense; ATGGCAGTGACATGACTTCCCTGCA
>probe:Drosophila_2:1624468_a_at:427:107; Interrogation_Position=954; Antisense; AGAACATCTTCCCAAGCGCTATGGT
>probe:Drosophila_2:1624468_a_at:489:339; Interrogation_Position=971; Antisense; GCTATGGTGGCTTGCACGAGGACTA
>probe:Drosophila_2:1624468_a_at:650:73; Interrogation_Position=989; Antisense; AGGACTACTCTTATACGCTCTGGTT

Paste this into a BLAST search page for me
ATACGCTCTGGTTGGATATGCTGAAGGGATTCATCTTTGACTAGGCTTCAACCGTCGACGATATATTTCGCGCCAGGAACCCATCTCACAGATTGTCGGAATATTCGATCTGAAGGACCTGGGCTGGACCTGGGCTTGGAACACATACTCGAGTCCCAGCGTGGCTCAGAAGATGATGATTGCTCTACTAGTGACCTCCAGAACATCCGCCCTTCATATTGTAAAAGAATTGGGTCTTCAACGCGGCATTATGGCAGTGACATGACTTCCCTGCAAGAACATCTTCCCAAGCGCTATGGTGCTATGGTGGCTTGCACGAGGACTAAGGACTACTCTTATACGCTCTGGTT

Full Affymetrix probeset data:

Annotations for 1624468_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime