FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624469_at:

>probe:Drosophila_2:1624469_at:328:407; Interrogation_Position=1184; Antisense; GACGGATCGCACCACGAGAATGCTG
>probe:Drosophila_2:1624469_at:68:423; Interrogation_Position=1199; Antisense; GAGAATGCTGCTGGCGGTGCTACTC
>probe:Drosophila_2:1624469_at:614:669; Interrogation_Position=1219; Antisense; TACTCCTCTTTCTCATCACTGAATT
>probe:Drosophila_2:1624469_at:406:51; Interrogation_Position=1270; Antisense; ATGCTGTGCTCGGAGATGTCTTCTA
>probe:Drosophila_2:1624469_at:658:59; Interrogation_Position=1285; Antisense; ATGTCTTCTATCTGCAGTGCTACCT
>probe:Drosophila_2:1624469_at:637:507; Interrogation_Position=1301; Antisense; GTGCTACCTAAGACTGAGTGACCTG
>probe:Drosophila_2:1624469_at:357:413; Interrogation_Position=1320; Antisense; GACCTGATGGATATCTTGGCCCTGA
>probe:Drosophila_2:1624469_at:352:33; Interrogation_Position=1344; Antisense; ATCAACTCCAGCATCAACTTCATTT
>probe:Drosophila_2:1624469_at:497:191; Interrogation_Position=1359; Antisense; AACTTCATTTTGTACTGCTCCATGA
>probe:Drosophila_2:1624469_at:521:603; Interrogation_Position=1411; Antisense; TGCTCTTTCGTCCAAAATTCCTGGA
>probe:Drosophila_2:1624469_at:626:555; Interrogation_Position=1457; Antisense; GGACGAAATGGCAGCTGCTCGAGCT
>probe:Drosophila_2:1624469_at:212:87; Interrogation_Position=1569; Antisense; AGTCGCCTGCTGAGTGTCCTGAAAC
>probe:Drosophila_2:1624469_at:97:199; Interrogation_Position=1659; Antisense; AACGATGCGGTGGAACCAGCGTTCC
>probe:Drosophila_2:1624469_at:87:331; Interrogation_Position=1714; Antisense; GCGGTGCCACGGAGAATCAGCTGTA

Paste this into a BLAST search page for me
GACGGATCGCACCACGAGAATGCTGGAGAATGCTGCTGGCGGTGCTACTCTACTCCTCTTTCTCATCACTGAATTATGCTGTGCTCGGAGATGTCTTCTAATGTCTTCTATCTGCAGTGCTACCTGTGCTACCTAAGACTGAGTGACCTGGACCTGATGGATATCTTGGCCCTGAATCAACTCCAGCATCAACTTCATTTAACTTCATTTTGTACTGCTCCATGATGCTCTTTCGTCCAAAATTCCTGGAGGACGAAATGGCAGCTGCTCGAGCTAGTCGCCTGCTGAGTGTCCTGAAACAACGATGCGGTGGAACCAGCGTTCCGCGGTGCCACGGAGAATCAGCTGTA

Full Affymetrix probeset data:

Annotations for 1624469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720