FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624472_at:

>probe:Drosophila_2:1624472_at:238:523; Interrogation_Position=1640; Antisense; GGGCCAGCTTTCAGAATCGGGCAAA
>probe:Drosophila_2:1624472_at:504:563; Interrogation_Position=1687; Antisense; GGAAGATTCTTTTCCAACATCTGCT
>probe:Drosophila_2:1624472_at:185:23; Interrogation_Position=1715; Antisense; ATATAGGACTGCAGTGGGCCGCTGA
>probe:Drosophila_2:1624472_at:282:81; Interrogation_Position=1766; Antisense; AGGGAGTGGCCTTCATCCACACGAT
>probe:Drosophila_2:1624472_at:442:585; Interrogation_Position=1799; Antisense; TGGCAATGTTGATGTCCCCACCAGT
>probe:Drosophila_2:1624472_at:680:309; Interrogation_Position=1816; Antisense; CCACCAGTGGTCTATCTTTCCAAAA
>probe:Drosophila_2:1624472_at:661:353; Interrogation_Position=1853; Antisense; GCACGCTGATAGTTTTGGGAGCCCT
>probe:Drosophila_2:1624472_at:671:413; Interrogation_Position=1871; Antisense; GAGCCCTGGGTATCTTTGGTGGACT
>probe:Drosophila_2:1624472_at:503:389; Interrogation_Position=1915; Antisense; GAAACGTTGAATCACGAACTCCCGG
>probe:Drosophila_2:1624472_at:12:383; Interrogation_Position=1930; Antisense; GAACTCCCGGAAACTCTCAGTGATG
>probe:Drosophila_2:1624472_at:657:169; Interrogation_Position=1976; Antisense; AAAGGATTTGGCACATGCCCTGCTG
>probe:Drosophila_2:1624472_at:276:705; Interrogation_Position=2065; Antisense; TTATCGAAGGACGAGTTCCGCTCCA
>probe:Drosophila_2:1624472_at:317:95; Interrogation_Position=2111; Antisense; AATACAGGTTTGAGTCCCACCCGAG
>probe:Drosophila_2:1624472_at:526:133; Interrogation_Position=2129; Antisense; ACCCGAGTCCATCATCGAGTGATTA

Paste this into a BLAST search page for me
GGGCCAGCTTTCAGAATCGGGCAAAGGAAGATTCTTTTCCAACATCTGCTATATAGGACTGCAGTGGGCCGCTGAAGGGAGTGGCCTTCATCCACACGATTGGCAATGTTGATGTCCCCACCAGTCCACCAGTGGTCTATCTTTCCAAAAGCACGCTGATAGTTTTGGGAGCCCTGAGCCCTGGGTATCTTTGGTGGACTGAAACGTTGAATCACGAACTCCCGGGAACTCCCGGAAACTCTCAGTGATGAAAGGATTTGGCACATGCCCTGCTGTTATCGAAGGACGAGTTCCGCTCCAAATACAGGTTTGAGTCCCACCCGAGACCCGAGTCCATCATCGAGTGATTA

Full Affymetrix probeset data:

Annotations for 1624472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720