FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624473_at:

>probe:Drosophila_2:1624473_at:143:373; Interrogation_Position=1173; Antisense; GAAGGGTTCCATGGTCAACTACACA
>probe:Drosophila_2:1624473_at:441:279; Interrogation_Position=1200; Antisense; CTACTCGTGCGCCAAGATTATCAAG
>probe:Drosophila_2:1624473_at:653:463; Interrogation_Position=1243; Antisense; GATTGCCACGGCTGTCCGTATAAGA
>probe:Drosophila_2:1624473_at:50:383; Interrogation_Position=1266; Antisense; GAACATGGATCAGGGCTCGTTGAAA
>probe:Drosophila_2:1624473_at:472:467; Interrogation_Position=1284; Antisense; GTTGAAAACCAAGCTGTCCTCCTAT
>probe:Drosophila_2:1624473_at:237:649; Interrogation_Position=1315; Antisense; TCAGCCAGTGCCATCGACGAGGTGA
>probe:Drosophila_2:1624473_at:502:503; Interrogation_Position=1350; Antisense; GTCCCGCGGTCACTATCAAATTGGA
>probe:Drosophila_2:1624473_at:252:187; Interrogation_Position=1435; Antisense; AACAACTACTTCGAGGAGAGCCAGA
>probe:Drosophila_2:1624473_at:286:27; Interrogation_Position=1459; Antisense; ATAGCGATGGGCAACCGGCAGAAGC
>probe:Drosophila_2:1624473_at:337:109; Interrogation_Position=1478; Antisense; AGAAGCGCGCCAATGGTTCTGCTCC
>probe:Drosophila_2:1624473_at:41:47; Interrogation_Position=1516; Antisense; ATCCGTCCAGATATCAAGGGCCATG
>probe:Drosophila_2:1624473_at:462:41; Interrogation_Position=1544; Antisense; ATCGGTCCATGCTGATGGGTGACGA
>probe:Drosophila_2:1624473_at:248:201; Interrogation_Position=1596; Antisense; AACCCAGGAGCGTATCATGCAGAGC
>probe:Drosophila_2:1624473_at:186:75; Interrogation_Position=1625; Antisense; AGGACATATCCGAGGCCTTCAATGA

Paste this into a BLAST search page for me
GAAGGGTTCCATGGTCAACTACACACTACTCGTGCGCCAAGATTATCAAGGATTGCCACGGCTGTCCGTATAAGAGAACATGGATCAGGGCTCGTTGAAAGTTGAAAACCAAGCTGTCCTCCTATTCAGCCAGTGCCATCGACGAGGTGAGTCCCGCGGTCACTATCAAATTGGAAACAACTACTTCGAGGAGAGCCAGAATAGCGATGGGCAACCGGCAGAAGCAGAAGCGCGCCAATGGTTCTGCTCCATCCGTCCAGATATCAAGGGCCATGATCGGTCCATGCTGATGGGTGACGAAACCCAGGAGCGTATCATGCAGAGCAGGACATATCCGAGGCCTTCAATGA

Full Affymetrix probeset data:

Annotations for 1624473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720