FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624474_at:

>probe:Drosophila_2:1624474_at:451:517; Interrogation_Position=1110; Antisense; GTGGGTGCTATCTTCATACTTTTGA
>probe:Drosophila_2:1624474_at:541:5; Interrogation_Position=1152; Antisense; ATTGTCACTCGTGGACATCCGGAAC
>probe:Drosophila_2:1624474_at:278:565; Interrogation_Position=1202; Antisense; GGCAAGTAGCCGCTTCAAGAGCATC
>probe:Drosophila_2:1624474_at:405:213; Interrogation_Position=1218; Antisense; AAGAGCATCCAATACGAGCGTTCCG
>probe:Drosophila_2:1624474_at:435:415; Interrogation_Position=1233; Antisense; GAGCGTTCCGAACCAAATCGACGTA
>probe:Drosophila_2:1624474_at:136:253; Interrogation_Position=1246; Antisense; CAAATCGACGTAGTCCCCGGTGGTG
>probe:Drosophila_2:1624474_at:124:413; Interrogation_Position=1270; Antisense; GACCCGCCACTAAAAGCACATTAAT
>probe:Drosophila_2:1624474_at:433:597; Interrogation_Position=1294; Antisense; TGTCTAGCAAAGTGTTCCGAGGTGT
>probe:Drosophila_2:1624474_at:142:431; Interrogation_Position=1392; Antisense; GAGTCCGAGGGTATTTGCCCTGCAA
>probe:Drosophila_2:1624474_at:644:527; Interrogation_Position=1422; Antisense; GGGACACCTATGAGATTTACAGATT
>probe:Drosophila_2:1624474_at:331:689; Interrogation_Position=1471; Antisense; TATTAATTGGCGTGCCACTGGCGCA
>probe:Drosophila_2:1624474_at:263:143; Interrogation_Position=1487; Antisense; ACTGGCGCACAATCGCATGCTTATT
>probe:Drosophila_2:1624474_at:381:347; Interrogation_Position=1501; Antisense; GCATGCTTATTAACCCCACTGTTAA
>probe:Drosophila_2:1624474_at:60:47; Interrogation_Position=1561; Antisense; ATCCGTTTAGTGTTAGATCCTGTAA

Paste this into a BLAST search page for me
GTGGGTGCTATCTTCATACTTTTGAATTGTCACTCGTGGACATCCGGAACGGCAAGTAGCCGCTTCAAGAGCATCAAGAGCATCCAATACGAGCGTTCCGGAGCGTTCCGAACCAAATCGACGTACAAATCGACGTAGTCCCCGGTGGTGGACCCGCCACTAAAAGCACATTAATTGTCTAGCAAAGTGTTCCGAGGTGTGAGTCCGAGGGTATTTGCCCTGCAAGGGACACCTATGAGATTTACAGATTTATTAATTGGCGTGCCACTGGCGCAACTGGCGCACAATCGCATGCTTATTGCATGCTTATTAACCCCACTGTTAAATCCGTTTAGTGTTAGATCCTGTAA

Full Affymetrix probeset data:

Annotations for 1624474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720