FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624475_at:

>probe:Drosophila_2:1624475_at:183:585; Interrogation_Position=1391; Antisense; TGGCACCTTCTATGAGTTTGGCGAG
>probe:Drosophila_2:1624475_at:223:77; Interrogation_Position=1414; Antisense; AGGATATTCCCGAGGCTCCTGAGCG
>probe:Drosophila_2:1624475_at:176:137; Interrogation_Position=1459; Antisense; ACGAACCCATTATGCTGTGCCGTTT
>probe:Drosophila_2:1624475_at:584:597; Interrogation_Position=1474; Antisense; TGTGCCGTTTCCCAGCGGAAATCAA
>probe:Drosophila_2:1624475_at:29:561; Interrogation_Position=1490; Antisense; GGAAATCAAGTCCTTCTACATGCAG
>probe:Drosophila_2:1624475_at:709:73; Interrogation_Position=1525; Antisense; AGGACCAGCGTTTGACCGAGAGCGT
>probe:Drosophila_2:1624475_at:295:103; Interrogation_Position=1543; Antisense; AGAGCGTGGACGTTCTGCTGCCAAA
>probe:Drosophila_2:1624475_at:640:123; Interrogation_Position=1678; Antisense; AGCGCGTCTATGGAACCATGCCACA
>probe:Drosophila_2:1624475_at:127:279; Interrogation_Position=1709; Antisense; CTATGGTTTGGGACTGGAGCGCTTC
>probe:Drosophila_2:1624475_at:65:465; Interrogation_Position=1786; Antisense; GATTCCTCGACAGATGCAGGCCCTA
>probe:Drosophila_2:1624475_at:119:101; Interrogation_Position=1824; Antisense; AGAGCAATCCGTCAGCCGGCATTTA
>probe:Drosophila_2:1624475_at:6:531; Interrogation_Position=1852; Antisense; GGGTCGTAGAACTTCTTGCTACCTA
>probe:Drosophila_2:1624475_at:256:685; Interrogation_Position=1945; Antisense; TATCAAAGAATAAAGGCCGCGCCTC
>probe:Drosophila_2:1624475_at:261:323; Interrogation_Position=1963; Antisense; GCGCCTCCGCTTCATTCAATGAAAT

Paste this into a BLAST search page for me
TGGCACCTTCTATGAGTTTGGCGAGAGGATATTCCCGAGGCTCCTGAGCGACGAACCCATTATGCTGTGCCGTTTTGTGCCGTTTCCCAGCGGAAATCAAGGAAATCAAGTCCTTCTACATGCAGAGGACCAGCGTTTGACCGAGAGCGTAGAGCGTGGACGTTCTGCTGCCAAAAGCGCGTCTATGGAACCATGCCACACTATGGTTTGGGACTGGAGCGCTTCGATTCCTCGACAGATGCAGGCCCTAAGAGCAATCCGTCAGCCGGCATTTAGGGTCGTAGAACTTCTTGCTACCTATATCAAAGAATAAAGGCCGCGCCTCGCGCCTCCGCTTCATTCAATGAAAT

Full Affymetrix probeset data:

Annotations for 1624475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720