FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624476_at:

>probe:Drosophila_2:1624476_at:577:493; Interrogation_Position=406; Antisense; GTCAGCAACAGAGCATCGTGCCCGT
>probe:Drosophila_2:1624476_at:135:713; Interrogation_Position=486; Antisense; TTCTTCTGGACCTCAGCCGAGGGAG
>probe:Drosophila_2:1624476_at:690:105; Interrogation_Position=517; Antisense; AGCACCACGAACAGCAGTTGCGCCA
>probe:Drosophila_2:1624476_at:73:99; Interrogation_Position=541; Antisense; AGCAGTTCGACCGTTGGGTTCAGGC
>probe:Drosophila_2:1624476_at:455:541; Interrogation_Position=557; Antisense; GGTTCAGGCCTAAACATCGCCAGGA
>probe:Drosophila_2:1624476_at:425:77; Interrogation_Position=578; Antisense; AGGATGCACAGTTCCACTTCTCGAT
>probe:Drosophila_2:1624476_at:229:147; Interrogation_Position=593; Antisense; ACTTCTCGATGCACCGGGAAAAACT
>probe:Drosophila_2:1624476_at:567:697; Interrogation_Position=630; Antisense; TTTAAGTGCAAGTGTCTCCGTCCAT
>probe:Drosophila_2:1624476_at:434:441; Interrogation_Position=664; Antisense; GATGGATGCGGGTTCAGCTTCGCAT
>probe:Drosophila_2:1624476_at:698:343; Interrogation_Position=680; Antisense; GCTTCGCATGTTCGTAATCTCAGGG
>probe:Drosophila_2:1624476_at:353:95; Interrogation_Position=718; Antisense; AGATTGGATTCTTTGGGCTCGCGTC
>probe:Drosophila_2:1624476_at:171:257; Interrogation_Position=779; Antisense; CACAATCAAGCGTTACTATCGTTAA
>probe:Drosophila_2:1624476_at:128:513; Interrogation_Position=810; Antisense; GTGATTTATCGTGTCTTATTAGCCT
>probe:Drosophila_2:1624476_at:694:495; Interrogation_Position=842; Antisense; GTCTTAGCCGAATCATTGTCTTCCA

Paste this into a BLAST search page for me
GTCAGCAACAGAGCATCGTGCCCGTTTCTTCTGGACCTCAGCCGAGGGAGAGCACCACGAACAGCAGTTGCGCCAAGCAGTTCGACCGTTGGGTTCAGGCGGTTCAGGCCTAAACATCGCCAGGAAGGATGCACAGTTCCACTTCTCGATACTTCTCGATGCACCGGGAAAAACTTTTAAGTGCAAGTGTCTCCGTCCATGATGGATGCGGGTTCAGCTTCGCATGCTTCGCATGTTCGTAATCTCAGGGAGATTGGATTCTTTGGGCTCGCGTCCACAATCAAGCGTTACTATCGTTAAGTGATTTATCGTGTCTTATTAGCCTGTCTTAGCCGAATCATTGTCTTCCA

Full Affymetrix probeset data:

Annotations for 1624476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720