FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624478_at:

>probe:Drosophila_2:1624478_at:578:15; Interrogation_Position=1093; Antisense; ATTATGAATGTTTTGCGGCCGCGGC
>probe:Drosophila_2:1624478_at:566:331; Interrogation_Position=1107; Antisense; GCGGCCGCGGCAGCTTAGAAAATAA
>probe:Drosophila_2:1624478_at:428:463; Interrogation_Position=621; Antisense; GATTCGAGTGAACTGGTAGCCTTTA
>probe:Drosophila_2:1624478_at:141:107; Interrogation_Position=648; Antisense; AGCACAGTTACCGATTTCCGAGACT
>probe:Drosophila_2:1624478_at:38:379; Interrogation_Position=679; Antisense; GAAGCGCACCTTTTTGTAACGCGTT
>probe:Drosophila_2:1624478_at:391:675; Interrogation_Position=733; Antisense; TAGACGGATGTTTCTACCTTTCACC
>probe:Drosophila_2:1624478_at:63:129; Interrogation_Position=748; Antisense; ACCTTTCACCCTTTGGAGTCTATAT
>probe:Drosophila_2:1624478_at:218:611; Interrogation_Position=779; Antisense; TGACGATGGCATCTTACCGCGAAAT
>probe:Drosophila_2:1624478_at:168:393; Interrogation_Position=799; Antisense; GAAATCCACTAGCTAGTCGTGCCTA
>probe:Drosophila_2:1624478_at:18:531; Interrogation_Position=875; Antisense; GGGTTCCATAAATGTAGCTCTGCTT
>probe:Drosophila_2:1624478_at:76:119; Interrogation_Position=890; Antisense; AGCTCTGCTTAGTTATCCTTGGATG
>probe:Drosophila_2:1624478_at:184:215; Interrogation_Position=922; Antisense; AAGAGGATCTGGCTAGTTCAAACTA
>probe:Drosophila_2:1624478_at:470:687; Interrogation_Position=964; Antisense; TATATGCGTCATGACCAGCTCCAGA
>probe:Drosophila_2:1624478_at:597:309; Interrogation_Position=978; Antisense; CCAGCTCCAGATCAGGTTGTTCAGA

Paste this into a BLAST search page for me
ATTATGAATGTTTTGCGGCCGCGGCGCGGCCGCGGCAGCTTAGAAAATAAGATTCGAGTGAACTGGTAGCCTTTAAGCACAGTTACCGATTTCCGAGACTGAAGCGCACCTTTTTGTAACGCGTTTAGACGGATGTTTCTACCTTTCACCACCTTTCACCCTTTGGAGTCTATATTGACGATGGCATCTTACCGCGAAATGAAATCCACTAGCTAGTCGTGCCTAGGGTTCCATAAATGTAGCTCTGCTTAGCTCTGCTTAGTTATCCTTGGATGAAGAGGATCTGGCTAGTTCAAACTATATATGCGTCATGACCAGCTCCAGACCAGCTCCAGATCAGGTTGTTCAGA

Full Affymetrix probeset data:

Annotations for 1624478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720