FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624479_at:

>probe:Drosophila_2:1624479_at:274:379; Interrogation_Position=382; Antisense; GAAGCGGGTCTCATGCACCGGGATA
>probe:Drosophila_2:1624479_at:385:687; Interrogation_Position=405; Antisense; TATTAAACCCGCCAATCTGCTTATC
>probe:Drosophila_2:1624479_at:583:283; Interrogation_Position=485; Antisense; CTGAAGACGAGTCGCGCCTTTATTC
>probe:Drosophila_2:1624479_at:666:537; Interrogation_Position=530; Antisense; GGTATCGAGCGCCAGAGATTCTATT
>probe:Drosophila_2:1624479_at:547:547; Interrogation_Position=625; Antisense; GGAGTGCCCCTGTTTGCGGGAACCA
>probe:Drosophila_2:1624479_at:246:527; Interrogation_Position=642; Antisense; GGGAACCACCGACATCGAGCAATTA
>probe:Drosophila_2:1624479_at:12:595; Interrogation_Position=686; Antisense; TGGGCAGCCCACGTCTGAATCAGTG
>probe:Drosophila_2:1624479_at:241:103; Interrogation_Position=714; Antisense; AGAGCTGACTTCTCTGCCGGATTAC
>probe:Drosophila_2:1624479_at:247:461; Interrogation_Position=733; Antisense; GATTACAGCAAGATACGGTTTCCCA
>probe:Drosophila_2:1624479_at:359:517; Interrogation_Position=763; Antisense; GTGGGCATTCACTGGGACAACTTGT
>probe:Drosophila_2:1624479_at:409:329; Interrogation_Position=805; Antisense; GCGGTGGAAATCAATCTGGTCTCGA
>probe:Drosophila_2:1624479_at:566:535; Interrogation_Position=822; Antisense; GGTCTCGAATCTGGTGGTCTACAAT
>probe:Drosophila_2:1624479_at:330:183; Interrogation_Position=851; Antisense; AAAACCGACTCAAGGCCAGCGAGGT
>probe:Drosophila_2:1624479_at:426:71; Interrogation_Position=872; Antisense; AGGTGGGTTCTGCTTCAAGTTTGAC

Paste this into a BLAST search page for me
GAAGCGGGTCTCATGCACCGGGATATATTAAACCCGCCAATCTGCTTATCCTGAAGACGAGTCGCGCCTTTATTCGGTATCGAGCGCCAGAGATTCTATTGGAGTGCCCCTGTTTGCGGGAACCAGGGAACCACCGACATCGAGCAATTATGGGCAGCCCACGTCTGAATCAGTGAGAGCTGACTTCTCTGCCGGATTACGATTACAGCAAGATACGGTTTCCCAGTGGGCATTCACTGGGACAACTTGTGCGGTGGAAATCAATCTGGTCTCGAGGTCTCGAATCTGGTGGTCTACAATAAAACCGACTCAAGGCCAGCGAGGTAGGTGGGTTCTGCTTCAAGTTTGAC

Full Affymetrix probeset data:

Annotations for 1624479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720