FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624480_at:

>probe:Drosophila_2:1624480_at:180:683; Interrogation_Position=198; Antisense; TATGTTTGTCAGCTCCAGCGGATCA
>probe:Drosophila_2:1624480_at:309:545; Interrogation_Position=217; Antisense; GGATCACCCTGAAGTTCTGCAAGAA
>probe:Drosophila_2:1624480_at:387:439; Interrogation_Position=256; Antisense; GAGGCATGCGCGACTTCATTGAGAA
>probe:Drosophila_2:1624480_at:201:403; Interrogation_Position=291; Antisense; GACTTTGCCAAAGAGAATCCCGGGA
>probe:Drosophila_2:1624480_at:47:367; Interrogation_Position=305; Antisense; GAATCCCGGGATTGTGGTCTATGTG
>probe:Drosophila_2:1624480_at:38:591; Interrogation_Position=319; Antisense; TGGTCTATGTGAAGCCCAGGCGCCA
>probe:Drosophila_2:1624480_at:94:133; Interrogation_Position=343; Antisense; ACCGCACGCCAGTTTTGGTGGGAGA
>probe:Drosophila_2:1624480_at:26:39; Interrogation_Position=423; Antisense; ATCTCCAAGTGGATTGACCTGCTAA
>probe:Drosophila_2:1624480_at:2:665; Interrogation_Position=445; Antisense; TAAAGACTCAAAACGGCAGCTCCAG
>probe:Drosophila_2:1624480_at:276:117; Interrogation_Position=468; Antisense; AGCTCCCTGCGACTCCGGAAAATGT
>probe:Drosophila_2:1624480_at:325:167; Interrogation_Position=487; Antisense; AAATGTGGCATACCGAAGTGCCCTC
>probe:Drosophila_2:1624480_at:633:651; Interrogation_Position=588; Antisense; TCAAAGCCGCTGGATACGCCGCAAA
>probe:Drosophila_2:1624480_at:14:179; Interrogation_Position=610; Antisense; AAACTGCCACCGAGAAGCTCATCGA
>probe:Drosophila_2:1624480_at:728:377; Interrogation_Position=623; Antisense; GAAGCTCATCGAGTTGTTCCGGCAA

Paste this into a BLAST search page for me
TATGTTTGTCAGCTCCAGCGGATCAGGATCACCCTGAAGTTCTGCAAGAAGAGGCATGCGCGACTTCATTGAGAAGACTTTGCCAAAGAGAATCCCGGGAGAATCCCGGGATTGTGGTCTATGTGTGGTCTATGTGAAGCCCAGGCGCCAACCGCACGCCAGTTTTGGTGGGAGAATCTCCAAGTGGATTGACCTGCTAATAAAGACTCAAAACGGCAGCTCCAGAGCTCCCTGCGACTCCGGAAAATGTAAATGTGGCATACCGAAGTGCCCTCTCAAAGCCGCTGGATACGCCGCAAAAAACTGCCACCGAGAAGCTCATCGAGAAGCTCATCGAGTTGTTCCGGCAA

Full Affymetrix probeset data:

Annotations for 1624480_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720