FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624482_at:

>probe:Drosophila_2:1624482_at:20:539; Interrogation_Position=2602; Antisense; GGTTTCCCCGAGCAGAGCGAACGTA
>probe:Drosophila_2:1624482_at:171:175; Interrogation_Position=2658; Antisense; AAAGCGTCCGGTTCTGGCCGATGAT
>probe:Drosophila_2:1624482_at:595:97; Interrogation_Position=2685; Antisense; AGATCTCGATGAAATTGCTGCCCAA
>probe:Drosophila_2:1624482_at:559:201; Interrogation_Position=2709; Antisense; AACCGAGGGCTATACTGGCGCAGAT
>probe:Drosophila_2:1624482_at:64:79; Interrogation_Position=2739; Antisense; AGGATTGGTCAAGCAGGCCTCCATG
>probe:Drosophila_2:1624482_at:690:395; Interrogation_Position=2774; Antisense; GACAATCTCTAAACAACGGCGACAC
>probe:Drosophila_2:1624482_at:663:237; Interrogation_Position=2800; Antisense; AATCTCGACGATTTGTGCGTACGCA
>probe:Drosophila_2:1624482_at:125:489; Interrogation_Position=2818; Antisense; GTACGCAGCCAGCATTTCCAGGAAG
>probe:Drosophila_2:1624482_at:126:71; Interrogation_Position=2837; Antisense; AGGAAGCTTTGCAGCAACTTCGGCC
>probe:Drosophila_2:1624482_at:620:149; Interrogation_Position=2853; Antisense; ACTTCGGCCCTCAGTTAACGAACAG
>probe:Drosophila_2:1624482_at:33:29; Interrogation_Position=2894; Antisense; ATAAACTGCGCCTGAAATATGCTGC
>probe:Drosophila_2:1624482_at:584:241; Interrogation_Position=2909; Antisense; AATATGCTGCACCAAGGGTACCCAC
>probe:Drosophila_2:1624482_at:121:219; Interrogation_Position=2922; Antisense; AAGGGTACCCACTCTAAATGATAAG
>probe:Drosophila_2:1624482_at:571:723; Interrogation_Position=2970; Antisense; TTGTTGATTTAGCACCATCGCGAAT

Paste this into a BLAST search page for me
GGTTTCCCCGAGCAGAGCGAACGTAAAAGCGTCCGGTTCTGGCCGATGATAGATCTCGATGAAATTGCTGCCCAAAACCGAGGGCTATACTGGCGCAGATAGGATTGGTCAAGCAGGCCTCCATGGACAATCTCTAAACAACGGCGACACAATCTCGACGATTTGTGCGTACGCAGTACGCAGCCAGCATTTCCAGGAAGAGGAAGCTTTGCAGCAACTTCGGCCACTTCGGCCCTCAGTTAACGAACAGATAAACTGCGCCTGAAATATGCTGCAATATGCTGCACCAAGGGTACCCACAAGGGTACCCACTCTAAATGATAAGTTGTTGATTTAGCACCATCGCGAAT

Full Affymetrix probeset data:

Annotations for 1624482_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720