Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624483_at:

>probe:Drosophila_2:1624483_at:476:429; Interrogation_Position=2059; Antisense; GAGTTTGCCATGAACCTTCTAAAGA
>probe:Drosophila_2:1624483_at:352:265; Interrogation_Position=2086; Antisense; CAGGGTGTTACACTGCCCAACGAAA
>probe:Drosophila_2:1624483_at:151:153; Interrogation_Position=2208; Antisense; ACAGGCTGCGCCACGGGATCAGTTC
>probe:Drosophila_2:1624483_at:472:649; Interrogation_Position=2226; Antisense; TCAGTTCGGCATGGTGCCAGGCGAT
>probe:Drosophila_2:1624483_at:97:109; Interrogation_Position=2264; Antisense; AGAAGGGCGACTTGTGCATGGCCAA
>probe:Drosophila_2:1624483_at:229:33; Interrogation_Position=2323; Antisense; ATCACGGGCGTGTCGGAGAAAACTT
>probe:Drosophila_2:1624483_at:14:389; Interrogation_Position=2340; Antisense; GAAAACTTGCGTGGTCTTCTTTATG
>probe:Drosophila_2:1624483_at:569:291; Interrogation_Position=2349; Antisense; CGTGGTCTTCTTTATGGGCTATGGA
>probe:Drosophila_2:1624483_at:536:481; Interrogation_Position=2386; Antisense; GTATTGAAGGTCGACATCCTGCCCA
>probe:Drosophila_2:1624483_at:664:143; Interrogation_Position=2433; Antisense; ACTGAGCAACTCAGCGCAGCAGCAG
>probe:Drosophila_2:1624483_at:196:359; Interrogation_Position=2499; Antisense; GCAACATTCACGCTACCGCGGAGAT
>probe:Drosophila_2:1624483_at:151:673; Interrogation_Position=2512; Antisense; TACCGCGGAGATCGTCAGACGCAGC
>probe:Drosophila_2:1624483_at:159:321; Interrogation_Position=2553; Antisense; GCCGCCCCACAAACGAGAGCATTGA
>probe:Drosophila_2:1624483_at:386:423; Interrogation_Position=2576; Antisense; GAGACAACATGGTAACAGCCTGTTA

Paste this into a BLAST search page for me
GAGTTTGCCATGAACCTTCTAAAGACAGGGTGTTACACTGCCCAACGAAAACAGGCTGCGCCACGGGATCAGTTCTCAGTTCGGCATGGTGCCAGGCGATAGAAGGGCGACTTGTGCATGGCCAAATCACGGGCGTGTCGGAGAAAACTTGAAAACTTGCGTGGTCTTCTTTATGCGTGGTCTTCTTTATGGGCTATGGAGTATTGAAGGTCGACATCCTGCCCAACTGAGCAACTCAGCGCAGCAGCAGGCAACATTCACGCTACCGCGGAGATTACCGCGGAGATCGTCAGACGCAGCGCCGCCCCACAAACGAGAGCATTGAGAGACAACATGGTAACAGCCTGTTA

Full Affymetrix probeset data:

Annotations for 1624483_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime