Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624484_a_at:

>probe:Drosophila_2:1624484_a_at:483:229; Interrogation_Position=1046; Antisense; AATGGGCAAATCAGCGTGTCGTAAT
>probe:Drosophila_2:1624484_a_at:370:209; Interrogation_Position=615; Antisense; AAGCAAGTGACCGTGCTAACCCATT
>probe:Drosophila_2:1624484_a_at:429:9; Interrogation_Position=637; Antisense; ATTCGACTTCACCAGCCGGTGGAAG
>probe:Drosophila_2:1624484_a_at:186:89; Interrogation_Position=660; Antisense; AGTAGCAGGCCCATCGGTGTTGGTT
>probe:Drosophila_2:1624484_a_at:107:725; Interrogation_Position=679; Antisense; TTGGTTCGGGCGTACAGGCTACTGT
>probe:Drosophila_2:1624484_a_at:112:585; Interrogation_Position=757; Antisense; TGGAGACGTCCATCGAACGGCTGAC
>probe:Drosophila_2:1624484_a_at:51:497; Interrogation_Position=786; Antisense; GTCAGCGAACAGCTCAGCTACATCA
>probe:Drosophila_2:1624484_a_at:126:437; Interrogation_Position=825; Antisense; GAGGAGCTCACCAAGGACGACGACT
>probe:Drosophila_2:1624484_a_at:471:409; Interrogation_Position=840; Antisense; GACGACGACTACTATTTTGCACTTA
>probe:Drosophila_2:1624484_a_at:507:693; Interrogation_Position=855; Antisense; TTTGCACTTAGCTTGGTGCCCGCAA
>probe:Drosophila_2:1624484_a_at:575:259; Interrogation_Position=885; Antisense; CACCTTTCGCTCAGTCGGAAGATGT
>probe:Drosophila_2:1624484_a_at:626:59; Interrogation_Position=906; Antisense; ATGTACGTGCGGTCCAAGATCCAGG
>probe:Drosophila_2:1624484_a_at:154:221; Interrogation_Position=947; Antisense; AAGTGAGGACTCAACGCTTGCCAAG
>probe:Drosophila_2:1624484_a_at:373:679; Interrogation_Position=978; Antisense; TAGGCGGTCCATTATATACATTTAC

Paste this into a BLAST search page for me
AATGGGCAAATCAGCGTGTCGTAATAAGCAAGTGACCGTGCTAACCCATTATTCGACTTCACCAGCCGGTGGAAGAGTAGCAGGCCCATCGGTGTTGGTTTTGGTTCGGGCGTACAGGCTACTGTTGGAGACGTCCATCGAACGGCTGACGTCAGCGAACAGCTCAGCTACATCAGAGGAGCTCACCAAGGACGACGACTGACGACGACTACTATTTTGCACTTATTTGCACTTAGCTTGGTGCCCGCAACACCTTTCGCTCAGTCGGAAGATGTATGTACGTGCGGTCCAAGATCCAGGAAGTGAGGACTCAACGCTTGCCAAGTAGGCGGTCCATTATATACATTTAC

Full Affymetrix probeset data:

Annotations for 1624484_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime