FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624485_at:

>probe:Drosophila_2:1624485_at:504:455; Interrogation_Position=2595; Antisense; GATAACCACACAATTGCCATATGCT
>probe:Drosophila_2:1624485_at:600:83; Interrogation_Position=2622; Antisense; AGTGGCTGCTGCGAATAGGCTTTAT
>probe:Drosophila_2:1624485_at:468:25; Interrogation_Position=2636; Antisense; ATAGGCTTTATACCACGGACTACAA
>probe:Drosophila_2:1624485_at:64:595; Interrogation_Position=2687; Antisense; TGGGCCTGTGGGTGATCTATAGCAC
>probe:Drosophila_2:1624485_at:728:685; Interrogation_Position=2704; Antisense; TATAGCACCTACAACTCCAACAATA
>probe:Drosophila_2:1624485_at:183:251; Interrogation_Position=2772; Antisense; CAACTTTAATATCACCCTGGACCAT
>probe:Drosophila_2:1624485_at:420:473; Interrogation_Position=2814; Antisense; GTTCATCGTGTGTGGCAATCTGTAT
>probe:Drosophila_2:1624485_at:692:39; Interrogation_Position=2831; Antisense; ATCTGTATGCCATCGATTCGGGAAC
>probe:Drosophila_2:1624485_at:102:527; Interrogation_Position=2898; Antisense; GGGCAAGCTGCTCAACACGAATCTG
>probe:Drosophila_2:1624485_at:248:665; Interrogation_Position=2962; Antisense; TACAATCCCCTGACTGTGGAACTCT
>probe:Drosophila_2:1624485_at:132:519; Interrogation_Position=2977; Antisense; GTGGAACTCTACTCCTGGGACAAGG
>probe:Drosophila_2:1624485_at:477:593; Interrogation_Position=2992; Antisense; TGGGACAAGGGCAACGCACTCACAT
>probe:Drosophila_2:1624485_at:358:113; Interrogation_Position=3035; Antisense; AGCAGCGTTTAATCTCCGACAATAG
>probe:Drosophila_2:1624485_at:439:215; Interrogation_Position=3090; Antisense; AAGATCTGCAGAGTCATGGCTCAAA

Paste this into a BLAST search page for me
GATAACCACACAATTGCCATATGCTAGTGGCTGCTGCGAATAGGCTTTATATAGGCTTTATACCACGGACTACAATGGGCCTGTGGGTGATCTATAGCACTATAGCACCTACAACTCCAACAATACAACTTTAATATCACCCTGGACCATGTTCATCGTGTGTGGCAATCTGTATATCTGTATGCCATCGATTCGGGAACGGGCAAGCTGCTCAACACGAATCTGTACAATCCCCTGACTGTGGAACTCTGTGGAACTCTACTCCTGGGACAAGGTGGGACAAGGGCAACGCACTCACATAGCAGCGTTTAATCTCCGACAATAGAAGATCTGCAGAGTCATGGCTCAAA

Full Affymetrix probeset data:

Annotations for 1624485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720