Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624487_at:

>probe:Drosophila_2:1624487_at:357:371; Interrogation_Position=1007; Antisense; GAAGGCTATACCGTGGTTCATCTCG
>probe:Drosophila_2:1624487_at:376:473; Interrogation_Position=1022; Antisense; GTTCATCTCGGATTGCACGCACAAG
>probe:Drosophila_2:1624487_at:348:215; Interrogation_Position=1065; Antisense; AAGTTTCTACGCAAGCACGAGTTCC
>probe:Drosophila_2:1624487_at:440:521; Interrogation_Position=1120; Antisense; GTGGCTATATCAGGGATCGTTCCTT
>probe:Drosophila_2:1624487_at:588:469; Interrogation_Position=1138; Antisense; GTTCCTTTATCCTGTGCGACAAAAG
>probe:Drosophila_2:1624487_at:147:511; Interrogation_Position=1206; Antisense; GTGCAACCTTGCCTGTATGTCTACA
>probe:Drosophila_2:1624487_at:14:681; Interrogation_Position=1221; Antisense; TATGTCTACATTAGCCAGGCATCCC
>probe:Drosophila_2:1624487_at:222:269; Interrogation_Position=1236; Antisense; CAGGCATCCCTGGTGATCTTTAAAG
>probe:Drosophila_2:1624487_at:276:93; Interrogation_Position=1262; Antisense; AGATCTCAACTACCGGAAACTGCTC
>probe:Drosophila_2:1624487_at:525:283; Interrogation_Position=1362; Antisense; CTGCGCGTCATTAAGTCCGATATCT
>probe:Drosophila_2:1624487_at:196:305; Interrogation_Position=1378; Antisense; CCGATATCTATTGTGGACTGCCCAT
>probe:Drosophila_2:1624487_at:497:581; Interrogation_Position=1474; Antisense; TGGCCATCAAGCATCGACTCTCGAG
>probe:Drosophila_2:1624487_at:232:677; Interrogation_Position=1528; Antisense; TAGTCGGTCTCATTAGATTTCCCAA
>probe:Drosophila_2:1624487_at:206:95; Interrogation_Position=1542; Antisense; AGATTTCCCAATTAACAGCCCATAT

Paste this into a BLAST search page for me
GAAGGCTATACCGTGGTTCATCTCGGTTCATCTCGGATTGCACGCACAAGAAGTTTCTACGCAAGCACGAGTTCCGTGGCTATATCAGGGATCGTTCCTTGTTCCTTTATCCTGTGCGACAAAAGGTGCAACCTTGCCTGTATGTCTACATATGTCTACATTAGCCAGGCATCCCCAGGCATCCCTGGTGATCTTTAAAGAGATCTCAACTACCGGAAACTGCTCCTGCGCGTCATTAAGTCCGATATCTCCGATATCTATTGTGGACTGCCCATTGGCCATCAAGCATCGACTCTCGAGTAGTCGGTCTCATTAGATTTCCCAAAGATTTCCCAATTAACAGCCCATAT

Full Affymetrix probeset data:

Annotations for 1624487_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime