Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624488_a_at:

>probe:Drosophila_2:1624488_a_at:689:169; Interrogation_Position=182; Antisense; AAAGGAATCGCCCTTCATGCTTGTG
>probe:Drosophila_2:1624488_a_at:484:275; Interrogation_Position=194; Antisense; CTTCATGCTTGTGGGTATTACCGGA
>probe:Drosophila_2:1624488_a_at:476:381; Interrogation_Position=257; Antisense; GAACCGCGGAACGATGAGCACCAGC
>probe:Drosophila_2:1624488_a_at:131:377; Interrogation_Position=316; Antisense; GAACCGTCGTCGGATGTCTGACCCT
>probe:Drosophila_2:1624488_a_at:196:91; Interrogation_Position=367; Antisense; AGTACCTGTTCGACAAGGCGCCCAA
>probe:Drosophila_2:1624488_a_at:702:277; Interrogation_Position=416; Antisense; CTAAAGACCATCTGATTGCTCGGCG
>probe:Drosophila_2:1624488_a_at:72:627; Interrogation_Position=435; Antisense; TCGGCGTCCCTCTCTAAAAATCACA
>probe:Drosophila_2:1624488_a_at:441:445; Interrogation_Position=461; Antisense; GATGACATCGGCTAGATCACTTACA
>probe:Drosophila_2:1624488_a_at:42:413; Interrogation_Position=498; Antisense; GACCCTCTATTTATTGCATCATCAT
>probe:Drosophila_2:1624488_a_at:39:65; Interrogation_Position=521; Antisense; ATGGTTCATACCGATCCACTTGGAT
>probe:Drosophila_2:1624488_a_at:589:549; Interrogation_Position=555; Antisense; GGAGGGCAGGACTCTCGCAAGTATT
>probe:Drosophila_2:1624488_a_at:214:359; Interrogation_Position=571; Antisense; GCAAGTATTCCCGAGCGTTCAAGCC
>probe:Drosophila_2:1624488_a_at:199:121; Interrogation_Position=584; Antisense; AGCGTTCAAGCCCACAACATTAGAT
>probe:Drosophila_2:1624488_a_at:636:453; Interrogation_Position=703; Antisense; GATAAATACCTCTCGCATGATATGA

Paste this into a BLAST search page for me
AAAGGAATCGCCCTTCATGCTTGTGCTTCATGCTTGTGGGTATTACCGGAGAACCGCGGAACGATGAGCACCAGCGAACCGTCGTCGGATGTCTGACCCTAGTACCTGTTCGACAAGGCGCCCAACTAAAGACCATCTGATTGCTCGGCGTCGGCGTCCCTCTCTAAAAATCACAGATGACATCGGCTAGATCACTTACAGACCCTCTATTTATTGCATCATCATATGGTTCATACCGATCCACTTGGATGGAGGGCAGGACTCTCGCAAGTATTGCAAGTATTCCCGAGCGTTCAAGCCAGCGTTCAAGCCCACAACATTAGATGATAAATACCTCTCGCATGATATGA

Full Affymetrix probeset data:

Annotations for 1624488_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime