Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624491_a_at:

>probe:Drosophila_2:1624491_a_at:131:421; Interrogation_Position=3045; Antisense; GAGCAGTCATGCCTTTGGGTATCCA
>probe:Drosophila_2:1624491_a_at:300:349; Interrogation_Position=3072; Antisense; GCAGGCTCTGAACATGTCCCACATG
>probe:Drosophila_2:1624491_a_at:727:715; Interrogation_Position=3121; Antisense; TTCTGCGGCAGTTCCATCAGTTCAG
>probe:Drosophila_2:1624491_a_at:257:121; Interrogation_Position=3158; Antisense; AGCGGGTTCAGCATGGAAATCCATC
>probe:Drosophila_2:1624491_a_at:703:391; Interrogation_Position=3173; Antisense; GAAATCCATCCATCCAATCTTGTAC
>probe:Drosophila_2:1624491_a_at:571:649; Interrogation_Position=3202; Antisense; TCAGCTTATGCTCCAAATTCTTCCA
>probe:Drosophila_2:1624491_a_at:411:163; Interrogation_Position=3216; Antisense; AAATTCTTCCACAACATTCCACATG
>probe:Drosophila_2:1624491_a_at:195:49; Interrogation_Position=3238; Antisense; ATGCCAGACTCTCCATATCAAATGC
>probe:Drosophila_2:1624491_a_at:377:673; Interrogation_Position=3299; Antisense; TAGCCAGTCGTATCAGAAAATCCAT
>probe:Drosophila_2:1624491_a_at:299:279; Interrogation_Position=3362; Antisense; CTACCTATTCGTATCTGTATGCATA
>probe:Drosophila_2:1624491_a_at:450:675; Interrogation_Position=3396; Antisense; TAGTTCTAACTATTCCCCAAATGCC
>probe:Drosophila_2:1624491_a_at:315:29; Interrogation_Position=3421; Antisense; ATACGTGTGTATCTGTTGTGCCCCA
>probe:Drosophila_2:1624491_a_at:46:705; Interrogation_Position=3461; Antisense; TTATGCCACAAATCAGTCCTCTAGT
>probe:Drosophila_2:1624491_a_at:647:131; Interrogation_Position=3533; Antisense; ACCGATGTTGTTGTACGATGTCCAA

Paste this into a BLAST search page for me
GAGCAGTCATGCCTTTGGGTATCCAGCAGGCTCTGAACATGTCCCACATGTTCTGCGGCAGTTCCATCAGTTCAGAGCGGGTTCAGCATGGAAATCCATCGAAATCCATCCATCCAATCTTGTACTCAGCTTATGCTCCAAATTCTTCCAAAATTCTTCCACAACATTCCACATGATGCCAGACTCTCCATATCAAATGCTAGCCAGTCGTATCAGAAAATCCATCTACCTATTCGTATCTGTATGCATATAGTTCTAACTATTCCCCAAATGCCATACGTGTGTATCTGTTGTGCCCCATTATGCCACAAATCAGTCCTCTAGTACCGATGTTGTTGTACGATGTCCAA

Full Affymetrix probeset data:

Annotations for 1624491_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime