FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624492_at:

>probe:Drosophila_2:1624492_at:687:561; Interrogation_Position=1040; Antisense; GGAACTTCCAGCAGACGTGCAGCAA
>probe:Drosophila_2:1624492_at:498:345; Interrogation_Position=1200; Antisense; GCATTTTTGCGCGATGTGATCTTGT
>probe:Drosophila_2:1624492_at:550:513; Interrogation_Position=1215; Antisense; GTGATCTTGTTTATCTGTTGCACAT
>probe:Drosophila_2:1624492_at:723:91; Interrogation_Position=1296; Antisense; AGTTTCCTAGGCTTTGCTATTCTTA
>probe:Drosophila_2:1624492_at:621:361; Interrogation_Position=746; Antisense; GCAATTGGCGGCTGGTCATGAGCAC
>probe:Drosophila_2:1624492_at:327:321; Interrogation_Position=779; Antisense; GCCCTCTCAAATATTCGGCCATTTG
>probe:Drosophila_2:1624492_at:406:315; Interrogation_Position=796; Antisense; GCCATTTGCGAGAAGTCTTTGCCGA
>probe:Drosophila_2:1624492_at:237:723; Interrogation_Position=814; Antisense; TTGCCGATATCCAAAGTGTTCTAGG
>probe:Drosophila_2:1624492_at:247:145; Interrogation_Position=852; Antisense; ACTCCAGATGAGAATTGTACCACAA
>probe:Drosophila_2:1624492_at:644:673; Interrogation_Position=869; Antisense; TACCACAACATCTACAGGCAACCAG
>probe:Drosophila_2:1624492_at:531:565; Interrogation_Position=885; Antisense; GGCAACCAGTTGGAAGTGCGCCAGA
>probe:Drosophila_2:1624492_at:162:187; Interrogation_Position=918; Antisense; AACAAGGCCATGTACGGCGTCGAGG
>probe:Drosophila_2:1624492_at:237:147; Interrogation_Position=971; Antisense; ACTAGAAGTGCAGCTGGAGGTCAAC
>probe:Drosophila_2:1624492_at:311:199; Interrogation_Position=993; Antisense; AACGAGACTTATCAACGCCGCATGT

Paste this into a BLAST search page for me
GGAACTTCCAGCAGACGTGCAGCAAGCATTTTTGCGCGATGTGATCTTGTGTGATCTTGTTTATCTGTTGCACATAGTTTCCTAGGCTTTGCTATTCTTAGCAATTGGCGGCTGGTCATGAGCACGCCCTCTCAAATATTCGGCCATTTGGCCATTTGCGAGAAGTCTTTGCCGATTGCCGATATCCAAAGTGTTCTAGGACTCCAGATGAGAATTGTACCACAATACCACAACATCTACAGGCAACCAGGGCAACCAGTTGGAAGTGCGCCAGAAACAAGGCCATGTACGGCGTCGAGGACTAGAAGTGCAGCTGGAGGTCAACAACGAGACTTATCAACGCCGCATGT

Full Affymetrix probeset data:

Annotations for 1624492_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720