FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624496_at:

>probe:Drosophila_2:1624496_at:130:463; Interrogation_Position=1269; Antisense; GATTCCCAAATACTTTTTCATGCAG
>probe:Drosophila_2:1624496_at:400:695; Interrogation_Position=1284; Antisense; TTTCATGCAGTATCCATCTAAGGTT
>probe:Drosophila_2:1624496_at:713:561; Interrogation_Position=1354; Antisense; GGAACTCGAGTTTGCATATTTAGGT
>probe:Drosophila_2:1624496_at:75:689; Interrogation_Position=1373; Antisense; TTAGGTATTCTAATGTTCCAACACA
>probe:Drosophila_2:1624496_at:390:101; Interrogation_Position=1429; Antisense; AGAGCGCTTCGGAAAATCATTTGAC
>probe:Drosophila_2:1624496_at:525:685; Interrogation_Position=1470; Antisense; TATAGAAATGTATCGGCAGCCGCAG
>probe:Drosophila_2:1624496_at:155:639; Interrogation_Position=1482; Antisense; TCGGCAGCCGCAGATTAACGATCTA
>probe:Drosophila_2:1624496_at:81:199; Interrogation_Position=1498; Antisense; AACGATCTAGTCAGGATTGCTATGT
>probe:Drosophila_2:1624496_at:676:587; Interrogation_Position=1537; Antisense; TGGATTTTATTTTGCTTACCCTGGA
>probe:Drosophila_2:1624496_at:306:343; Interrogation_Position=1550; Antisense; GCTTACCCTGGAATTATACTCGAAT
>probe:Drosophila_2:1624496_at:8:619; Interrogation_Position=1576; Antisense; TGCAGAGGACGAAGCATCGCCACCA
>probe:Drosophila_2:1624496_at:158:271; Interrogation_Position=1590; Antisense; CATCGCCACCATTTTCATGTCAATT
>probe:Drosophila_2:1624496_at:688:19; Interrogation_Position=1654; Antisense; ATTTGACTCCAATCTCTGTATGATG
>probe:Drosophila_2:1624496_at:27:113; Interrogation_Position=1805; Antisense; AGCAAATGCGCTGAACACTAAAATA

Paste this into a BLAST search page for me
GATTCCCAAATACTTTTTCATGCAGTTTCATGCAGTATCCATCTAAGGTTGGAACTCGAGTTTGCATATTTAGGTTTAGGTATTCTAATGTTCCAACACAAGAGCGCTTCGGAAAATCATTTGACTATAGAAATGTATCGGCAGCCGCAGTCGGCAGCCGCAGATTAACGATCTAAACGATCTAGTCAGGATTGCTATGTTGGATTTTATTTTGCTTACCCTGGAGCTTACCCTGGAATTATACTCGAATTGCAGAGGACGAAGCATCGCCACCACATCGCCACCATTTTCATGTCAATTATTTGACTCCAATCTCTGTATGATGAGCAAATGCGCTGAACACTAAAATA

Full Affymetrix probeset data:

Annotations for 1624496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720