FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624498_at:

>probe:Drosophila_2:1624498_at:319:593; Interrogation_Position=434; Antisense; TGGGTATACTCCATGCTGATATCGC
>probe:Drosophila_2:1624498_at:515:509; Interrogation_Position=465; Antisense; GTGCTTTCAGCTGCTCTTCATAGCA
>probe:Drosophila_2:1624498_at:472:381; Interrogation_Position=547; Antisense; GAACCCATTCCAATTATCAGACAGG
>probe:Drosophila_2:1624498_at:17:115; Interrogation_Position=572; Antisense; AGCAGGAGGTCAACTTCGACGGCTC
>probe:Drosophila_2:1624498_at:102:407; Interrogation_Position=589; Antisense; GACGGCTCCTACAAGTATCTGTACG
>probe:Drosophila_2:1624498_at:729:675; Interrogation_Position=604; Antisense; TATCTGTACGAGACGGGCAACGGCA
>probe:Drosophila_2:1624498_at:664:433; Interrogation_Position=643; Antisense; GAGGGCTACCTCAAGAATCCAGGCA
>probe:Drosophila_2:1624498_at:622:31; Interrogation_Position=671; Antisense; ATAATGCCGGCCAGGTCGCACAGGG
>probe:Drosophila_2:1624498_at:304:131; Interrogation_Position=714; Antisense; ACCCGAGGGCATTCCGATTCGGATA
>probe:Drosophila_2:1624498_at:329:545; Interrogation_Position=734; Antisense; GGATAACCTATCTGGCGGACGAGAA
>probe:Drosophila_2:1624498_at:53:489; Interrogation_Position=906; Antisense; GTCCGAATATCGTGGTAGTACCTCC
>probe:Drosophila_2:1624498_at:64:157; Interrogation_Position=942; Antisense; ACAGCCGGCTGTTCCAGGTGGAGAA
>probe:Drosophila_2:1624498_at:224:81; Interrogation_Position=957; Antisense; AGGTGGAGAACGCTGCAATGCATCT
>probe:Drosophila_2:1624498_at:382:53; Interrogation_Position=974; Antisense; ATGCATCTCCATTGAATCGTTTCTA

Paste this into a BLAST search page for me
TGGGTATACTCCATGCTGATATCGCGTGCTTTCAGCTGCTCTTCATAGCAGAACCCATTCCAATTATCAGACAGGAGCAGGAGGTCAACTTCGACGGCTCGACGGCTCCTACAAGTATCTGTACGTATCTGTACGAGACGGGCAACGGCAGAGGGCTACCTCAAGAATCCAGGCAATAATGCCGGCCAGGTCGCACAGGGACCCGAGGGCATTCCGATTCGGATAGGATAACCTATCTGGCGGACGAGAAGTCCGAATATCGTGGTAGTACCTCCACAGCCGGCTGTTCCAGGTGGAGAAAGGTGGAGAACGCTGCAATGCATCTATGCATCTCCATTGAATCGTTTCTA

Full Affymetrix probeset data:

Annotations for 1624498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720