FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624501_at:

>probe:Drosophila_2:1624501_at:44:551; Interrogation_Position=1042; Antisense; GGAGACTCCAGTCAAGGCCCTGAAG
>probe:Drosophila_2:1624501_at:587:69; Interrogation_Position=1056; Antisense; AGGCCCTGAAGAGGACCCGCAAGGA
>probe:Drosophila_2:1624501_at:230:297; Interrogation_Position=1100; Antisense; CCCATTAAGCGCTACAAGGTCGACG
>probe:Drosophila_2:1624501_at:670:245; Interrogation_Position=1114; Antisense; CAAGGTCGACGAGCGCAATTACTTC
>probe:Drosophila_2:1624501_at:10:1; Interrogation_Position=1131; Antisense; ATTACTTCGAGGTGGGATTGGCCCT
>probe:Drosophila_2:1624501_at:126:307; Interrogation_Position=1153; Antisense; CCTGCCCTCGTCTATATATGTCTGA
>probe:Drosophila_2:1624501_at:453:473; Interrogation_Position=1183; Antisense; GGTAATTTCAAACAGATCCTCGGAA
>probe:Drosophila_2:1624501_at:257:445; Interrogation_Position=1197; Antisense; GATCCTCGGAAAGCCACAAAAATGA
>probe:Drosophila_2:1624501_at:207:145; Interrogation_Position=1303; Antisense; ACTATGACGCTTAACTAGTTCCTAA
>probe:Drosophila_2:1624501_at:245:501; Interrogation_Position=1328; Antisense; GTCGTAAACTAATCATCTTTCAATT
>probe:Drosophila_2:1624501_at:521:489; Interrogation_Position=1356; Antisense; GTACATAATTTCTTAGGCCACCTTA
>probe:Drosophila_2:1624501_at:687:65; Interrogation_Position=1370; Antisense; AGGCCACCTTAATCACTATTTATTC
>probe:Drosophila_2:1624501_at:105:337; Interrogation_Position=1424; Antisense; GCTGCTGTTATGTAGTTTTCGAATA
>probe:Drosophila_2:1624501_at:664:215; Interrogation_Position=962; Antisense; AAGATTCCTCACAACTTGCTTGTCC

Paste this into a BLAST search page for me
GGAGACTCCAGTCAAGGCCCTGAAGAGGCCCTGAAGAGGACCCGCAAGGACCCATTAAGCGCTACAAGGTCGACGCAAGGTCGACGAGCGCAATTACTTCATTACTTCGAGGTGGGATTGGCCCTCCTGCCCTCGTCTATATATGTCTGAGGTAATTTCAAACAGATCCTCGGAAGATCCTCGGAAAGCCACAAAAATGAACTATGACGCTTAACTAGTTCCTAAGTCGTAAACTAATCATCTTTCAATTGTACATAATTTCTTAGGCCACCTTAAGGCCACCTTAATCACTATTTATTCGCTGCTGTTATGTAGTTTTCGAATAAAGATTCCTCACAACTTGCTTGTCC

Full Affymetrix probeset data:

Annotations for 1624501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720