FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624503_at:

>probe:Drosophila_2:1624503_at:449:633; Interrogation_Position=1661; Antisense; TCCCTTTATGCCATCGTGAAGAGAT
>probe:Drosophila_2:1624503_at:508:49; Interrogation_Position=1707; Antisense; ATGCCATACCATTAAATCCAGTTCG
>probe:Drosophila_2:1624503_at:64:359; Interrogation_Position=1765; Antisense; GCAAAAGTTGTGATTCCTGCACAGA
>probe:Drosophila_2:1624503_at:215:703; Interrogation_Position=1797; Antisense; TTATAGTTCCAGGTTGCCATCTCAG
>probe:Drosophila_2:1624503_at:726:313; Interrogation_Position=1812; Antisense; GCCATCTCAGTTTATCAGTTCGTTT
>probe:Drosophila_2:1624503_at:311:265; Interrogation_Position=1827; Antisense; CAGTTCGTTTTTTCTCTGTGTGAAT
>probe:Drosophila_2:1624503_at:31:597; Interrogation_Position=1843; Antisense; TGTGTGAATTCCATCCTCCTGCAGA
>probe:Drosophila_2:1624503_at:33:49; Interrogation_Position=1855; Antisense; ATCCTCCTGCAGACTGATTTTTGAT
>probe:Drosophila_2:1624503_at:186:391; Interrogation_Position=1938; Antisense; GAAACTATACTTTGTCGTCAGTCCA
>probe:Drosophila_2:1624503_at:473:501; Interrogation_Position=1951; Antisense; GTCGTCAGTCCAGAGATAAGCATAC
>probe:Drosophila_2:1624503_at:635:705; Interrogation_Position=2102; Antisense; TTACTGCACACGCAGAATTGTTGCA
>probe:Drosophila_2:1624503_at:150:463; Interrogation_Position=2134; Antisense; GATTACATATCAAACGCTCGCACTC
>probe:Drosophila_2:1624503_at:696:199; Interrogation_Position=2146; Antisense; AACGCTCGCACTCATATAATTTTAA
>probe:Drosophila_2:1624503_at:698:131; Interrogation_Position=2179; Antisense; ACCCAAAACTCATCAACTACATTCA

Paste this into a BLAST search page for me
TCCCTTTATGCCATCGTGAAGAGATATGCCATACCATTAAATCCAGTTCGGCAAAAGTTGTGATTCCTGCACAGATTATAGTTCCAGGTTGCCATCTCAGGCCATCTCAGTTTATCAGTTCGTTTCAGTTCGTTTTTTCTCTGTGTGAATTGTGTGAATTCCATCCTCCTGCAGAATCCTCCTGCAGACTGATTTTTGATGAAACTATACTTTGTCGTCAGTCCAGTCGTCAGTCCAGAGATAAGCATACTTACTGCACACGCAGAATTGTTGCAGATTACATATCAAACGCTCGCACTCAACGCTCGCACTCATATAATTTTAAACCCAAAACTCATCAACTACATTCA

Full Affymetrix probeset data:

Annotations for 1624503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720