FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624505_at:

>probe:Drosophila_2:1624505_at:65:463; Interrogation_Position=1019; Antisense; GATTCGACAAGCTCCAGCTGAACGA
>probe:Drosophila_2:1624505_at:723:277; Interrogation_Position=1036; Antisense; CTGAACGAGACTATGCTGCCGGTAA
>probe:Drosophila_2:1624505_at:89:621; Interrogation_Position=1052; Antisense; TGCCGGTAATCGTGGGTCATTCTCC
>probe:Drosophila_2:1624505_at:484:351; Interrogation_Position=1095; Antisense; GCAGATGCAGCATTTTGGACAGCTC
>probe:Drosophila_2:1624505_at:451:557; Interrogation_Position=1111; Antisense; GGACAGCTCAACAGATCTGGCGGTT
>probe:Drosophila_2:1624505_at:121:41; Interrogation_Position=1125; Antisense; ATCTGGCGGTTTCCGGCAGTATGAT
>probe:Drosophila_2:1624505_at:699:567; Interrogation_Position=1139; Antisense; GGCAGTATGATCACGGATGGCTCAG
>probe:Drosophila_2:1624505_at:72:441; Interrogation_Position=1154; Antisense; GATGGCTCAGAAACCACTGGATCTA
>probe:Drosophila_2:1624505_at:292:129; Interrogation_Position=1202; Antisense; ACCACCTGGAGAATGTTCGGGCCAA
>probe:Drosophila_2:1624505_at:471:177; Interrogation_Position=1248; Antisense; AAACGATTGGCTGGCTCCGCCGGAG
>probe:Drosophila_2:1624505_at:561:559; Interrogation_Position=1278; Antisense; GGAAATGCTGAACCGCAAGCTGCCC
>probe:Drosophila_2:1624505_at:293:361; Interrogation_Position=1292; Antisense; GCAAGCTGCCCAATGTCGTGGAGAA
>probe:Drosophila_2:1624505_at:117:551; Interrogation_Position=1335; Antisense; GGAGTTCAACCACTTGGATTTCATT
>probe:Drosophila_2:1624505_at:360:43; Interrogation_Position=1366; Antisense; ATCGATGCCCGGGAACTTTTGTGGG

Paste this into a BLAST search page for me
GATTCGACAAGCTCCAGCTGAACGACTGAACGAGACTATGCTGCCGGTAATGCCGGTAATCGTGGGTCATTCTCCGCAGATGCAGCATTTTGGACAGCTCGGACAGCTCAACAGATCTGGCGGTTATCTGGCGGTTTCCGGCAGTATGATGGCAGTATGATCACGGATGGCTCAGGATGGCTCAGAAACCACTGGATCTAACCACCTGGAGAATGTTCGGGCCAAAAACGATTGGCTGGCTCCGCCGGAGGGAAATGCTGAACCGCAAGCTGCCCGCAAGCTGCCCAATGTCGTGGAGAAGGAGTTCAACCACTTGGATTTCATTATCGATGCCCGGGAACTTTTGTGGG

Full Affymetrix probeset data:

Annotations for 1624505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720