FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624506_at:

>probe:Drosophila_2:1624506_at:213:407; Interrogation_Position=235; Antisense; GACTGGGTCCTGACTGCCGAGCACT
>probe:Drosophila_2:1624506_at:340:427; Interrogation_Position=266; Antisense; GAGATGCCGCTTCCGTGATCGTTTA
>probe:Drosophila_2:1624506_at:508:605; Interrogation_Position=281; Antisense; TGATCGTTTACTTCGGTGCCACCTG
>probe:Drosophila_2:1624506_at:378:585; Interrogation_Position=336; Antisense; TGGCAACGGCAACTTCATCAAGCAT
>probe:Drosophila_2:1624506_at:437:7; Interrogation_Position=359; Antisense; ATTCCAACGCTGATATCGCCCTGAT
>probe:Drosophila_2:1624506_at:653:659; Interrogation_Position=439; Antisense; TACAACGACCGTTACAACAACTACA
>probe:Drosophila_2:1624506_at:7:39; Interrogation_Position=542; Antisense; ATCTCCAGATCGTCCACAACGAAGA
>probe:Drosophila_2:1624506_at:553:159; Interrogation_Position=557; Antisense; ACAACGAAGAGTGCGGCTGGACCTA
>probe:Drosophila_2:1624506_at:509:555; Interrogation_Position=575; Antisense; GGACCTACGGCAGCGTTGGCGACAA
>probe:Drosophila_2:1624506_at:498:353; Interrogation_Position=584; Antisense; GCAGCGTTGGCGACAACGTCATCTG
>probe:Drosophila_2:1624506_at:728:499; Interrogation_Position=619; Antisense; GTCGACGGCAAGTCCATTTGCGGAG
>probe:Drosophila_2:1624506_at:216:157; Interrogation_Position=667; Antisense; ACACACGACGGCTCCAAGCTGGTGG
>probe:Drosophila_2:1624506_at:495:517; Interrogation_Position=688; Antisense; GTGGGAGTTAGCAACTTCGTCTCCT
>probe:Drosophila_2:1624506_at:265:143; Interrogation_Position=787; Antisense; ACTGGCATCTCTTACTAATTTTTCT

Paste this into a BLAST search page for me
GACTGGGTCCTGACTGCCGAGCACTGAGATGCCGCTTCCGTGATCGTTTATGATCGTTTACTTCGGTGCCACCTGTGGCAACGGCAACTTCATCAAGCATATTCCAACGCTGATATCGCCCTGATTACAACGACCGTTACAACAACTACAATCTCCAGATCGTCCACAACGAAGAACAACGAAGAGTGCGGCTGGACCTAGGACCTACGGCAGCGTTGGCGACAAGCAGCGTTGGCGACAACGTCATCTGGTCGACGGCAAGTCCATTTGCGGAGACACACGACGGCTCCAAGCTGGTGGGTGGGAGTTAGCAACTTCGTCTCCTACTGGCATCTCTTACTAATTTTTCT

Full Affymetrix probeset data:

Annotations for 1624506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720