FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624507_at:

>probe:Drosophila_2:1624507_at:131:483; Interrogation_Position=1016; Antisense; GTATCATTCTGGAAGAGACGACTCT
>probe:Drosophila_2:1624507_at:326:417; Interrogation_Position=1030; Antisense; GAGACGACTCTACCGAATAATATTA
>probe:Drosophila_2:1624507_at:555:197; Interrogation_Position=1092; Antisense; AACGATTACCGAAGAGGCGCCCGAT
>probe:Drosophila_2:1624507_at:519:323; Interrogation_Position=1108; Antisense; GCGCCCGATGCGATTCATACAACAA
>probe:Drosophila_2:1624507_at:332:209; Interrogation_Position=1172; Antisense; AAGCACAAGCCACAGAAATTCCAAC
>probe:Drosophila_2:1624507_at:357:25; Interrogation_Position=1243; Antisense; ATAGATGAGTTCAGGTTTCACGACA
>probe:Drosophila_2:1624507_at:302:479; Interrogation_Position=1257; Antisense; GTTTCACGACATTGGAACCCACATC
>probe:Drosophila_2:1624507_at:303:585; Interrogation_Position=1269; Antisense; TGGAACCCACATCGAGCACCGAAAG
>probe:Drosophila_2:1624507_at:221:393; Interrogation_Position=1289; Antisense; GAAAGCCCAGCGACAAGAGTATCAA
>probe:Drosophila_2:1624507_at:239:115; Interrogation_Position=766; Antisense; AGCAGTTCAGATCGTCAGTCAGTTA
>probe:Drosophila_2:1624507_at:658:371; Interrogation_Position=798; Antisense; GAAGGGCAACAATCTTGGCGAGAAA
>probe:Drosophila_2:1624507_at:586:19; Interrogation_Position=854; Antisense; ATTTGAATATCAGCCACGTCGGATC
>probe:Drosophila_2:1624507_at:619:443; Interrogation_Position=928; Antisense; GATGATATACCAATACCAGCCGATG
>probe:Drosophila_2:1624507_at:497:27; Interrogation_Position=940; Antisense; ATACCAGCCGATGTATCTGCAATAA

Paste this into a BLAST search page for me
GTATCATTCTGGAAGAGACGACTCTGAGACGACTCTACCGAATAATATTAAACGATTACCGAAGAGGCGCCCGATGCGCCCGATGCGATTCATACAACAAAAGCACAAGCCACAGAAATTCCAACATAGATGAGTTCAGGTTTCACGACAGTTTCACGACATTGGAACCCACATCTGGAACCCACATCGAGCACCGAAAGGAAAGCCCAGCGACAAGAGTATCAAAGCAGTTCAGATCGTCAGTCAGTTAGAAGGGCAACAATCTTGGCGAGAAAATTTGAATATCAGCCACGTCGGATCGATGATATACCAATACCAGCCGATGATACCAGCCGATGTATCTGCAATAA

Full Affymetrix probeset data:

Annotations for 1624507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720